Arctotis hirsuta

(Harv.) Beauverd · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arctotis

At a glance

Occurrence records269

Data sources10

Biological traits18

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Arctotis hirsuta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionNPASS59 compounds

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Arctotis hirsuta là một loài thực vật có hoa trong họ Cúc. Loài này được (Harv.) Beauverd mô tả khoa học đầu tiên năm 1915.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.5 m

Plant height min0.05 m

Seed mass1.15 mg

⚠ sources differ — TRY: 1.15 mg · GIFT: 1.22 mg

Seed mass max1.22 mg

Seed mass min1.22 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 060 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition59 compounds

Compounds documented for Arctotis hirsuta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids9

Eudesmane sesquiterpenoids5

Bisabolane sesquiterpenoids3

Caryophyllane sesquiterpenoids3

Dammarane and Protostane triterpenoids2

Documented compounds59 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(1R,2E,5R,6E,10S)-3,7-dimethyl-10-propan-2-ylcyclodeca-2,6-diene-1,5-diol	present	NPASS
(1R,2R,3S,6E,8R,10S)-6,10-dimethyl-3-propan-2-yl-11-oxabicyclo[8.1.0]undec-6-ene-2,8-diol	present	NPASS
(1R,2R,4aR,8R,8aS)-2-(2-hydroxypropan-2-yl)-4a-methyl-2,3,4,5,6,7,8,8a-octahydro-1H-naphthalene-1,8-diol	present	NPASS
(1R,4S,5E,7S)-4-methyl-10-methylidene-7-propan-2-ylcyclodec-5-ene-1,4-diol	present	NPASS
(1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1S,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1S,2S,3R,5S,8E,11S)-2-hydroxy-5,9-dimethyl-14-methylidene-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(1S,2S,3S,5R,8E,11S)-2-hydroxy-5,9-dimethyl-14-methylidene-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(1S,3R,5S,8E,10R,11S)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctotis hirsuta has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences9

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN837105.1 ↗641 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTATTGACAACCGGGCGTCATGGGGACGGGCTCATACCCCTTACCCGTGGTGCCCT …

Arctotis hirsuta voucher Funk & Koekemoer 12491 (US) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arctotis hirsuta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-fedorov — Vilmorin, Chopinet 1954

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type269 records

Wild obs. + sensor199

Museum / vouchered70

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 124≤1 km 23≤10 km 13>10 km 7

167 georeferenced · 32 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	38
Cape Town, ZA	19
University of Stellenboschlocation not on record	3
South African National Biodiversity Institutelocation not on record	3
MeiseBGlocation not on record	1
LDlocation not on record	1
GHPG$location not on record	1
MSB-3054location not on record	1
Kew, GB	1

9 institutions · 68 of 70 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Arctotis hirsuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)