Arctotis arctotoides

(L.fil.) O.Hoffm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arctotis

At a glance

Occurrence records533

Data sources11

Biological traits13

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Arctotis arctotoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF533 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Arctotis arctotoides là một loài thực vật có hoa trong họ Cúc. Loài này được (L.f.) O.Hoffm. mô tả khoa học đầu tiên năm 1910.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.07 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 355 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition15 compounds

Compounds documented for Arctotis arctotoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids2

Lupane triterpenoids2

Abietane diterpenoids1

Guaiane sesquiterpenoids1

Flavonols1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(3aR,4S,6aR,9S,9aR,9bR)-Octahydro-4-hydroxy-9-methyl-3,6-bis(methylene)azuleno(4,5-b)furan-2,8(3H,4H)-dione	present	NPASS
(3aR,5E,9E,11aS)-6-methyl-3-methylidene-2-oxo-3a,4,7,8,11,11a-hexahydrocyclodeca[b]furan-10-carboxylic acid	present	LOTUS
(E)-5-[(2R)-2-[(E)-4-hydroxy-2-methylbut-2-enyl]-5-oxo-2H-furan-4-yl]-2-methylpent-2-enal	present	LOTUS
[(E)-3-methyl-4-[(2R)-4-[(E)-4-methyl-5-oxopent-3-enyl]-5-oxo-2H-furan-2-yl]but-2-enyl] acetate	present	LOTUS
[(E)-4-[(2R)-4-[(E)-5-acetyloxy-4-methylpent-3-enyl]-5-oxo-2H-furan-2-yl]-3-methylbut-2-enyl] acetate	present	LOTUS
Abietic Acid	present	LOTUS
beta Farnesene	present	LOTUS
beta-Sitosterol	present	LOTUS
Dehydrobrachylaenolide	present	LOTUS
Jaranol	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctotis arctotoides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU846334.1 ↗642 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAATGACAACCGGGTGTCATGGGAACGGGCTCATACCCCATACCTATGGTGCCCT …

Arctotis arctotoides isolate NB1950 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arctotis arctotoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records16–182n range17median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Oberlander2016

CCDB · Oberlander2016 — Mckenzie,Mitchell & Barker, 2006

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Bilquez (Delay 1951)

n 92×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.

CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1981. In Chromosome number reports LXXI. Taxon 30: 514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type533 records

Wild obs. + sensor264

Museum / vouchered268

Cultivated / captive1

Range

Area of Occupancy AOO1 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 169≤1 km 24≤10 km 9>10 km 13

215 georeferenced · 49 without coordinates

Open the mapobservation + sensor264

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 31

31 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence268

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	172
Cape Town, ZA	26
Durban, ZA	14
Bronx, US	2
Denver, US	2
Kew, GB	2
University of Stellenboschlocation not on record	2
South Kensington, GB	2
Berlin, DE	1
Görlitz, DE	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
Saint Louis, US	1
MeiseBGlocation not on record	1

13 institutions · 227 of 268 vouchered records shown · 41 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Arctotis arctotoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)