Arctotis acaulis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arctotis

At a glance

Occurrence records620

Data sources6

Biological traits17

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Arctotis acaulis's data was compiled from.

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF620 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.4 m

Plant height min0.1 m

Seed mass5.94 mg

Seed mass max7.66 mg

Seed mass min4.5 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 200 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctotis acaulis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ889632.1 ↗641 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTATTGACAACCGGGCGCCATGGGGACGGGCTCATTCCCCTTACCTGTGGTGCCCT …

Arctotis acaulis voucher Koekemoer & Funk 1948 (PRE, US) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type620 records

Wild obs. + sensor479

Museum / vouchered141

Origin

Introduced9

Range

Area of Occupancy AOO1 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 325≤1 km 57≤10 km 11>10 km 14

407 georeferenced · 72 without coordinates

Open the mapobservation + sensor479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 6≤10 km 6

12 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	67
Cape Town, ZA	39
GHPG$location not on record	5
Stockholm, SE	5
Philadelphia, US	3
MSB-3054location not on record	3
GZUlocation not on record	3
South African National Biodiversity Institutelocation not on record	2
MeiseBGlocation not on record	2
University of Stellenboschlocation not on record	2
Kew, GB	1
Riverside, US	1
Bronx, US	1
Moscow State Universitylocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

16 institutions · 137 of 141 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Arctotis acaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)