Arctotheca forbesiana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arctotheca

At a glance

Occurrence records42

Data sources4

Biological traits12

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Arctotheca forbesiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF42 records

DNA & barcodingNCBIsequences

01Narrative

Arctotheca forbesiana est une espèce de plantes à fleurs de la famille des Asteraceae. Elle est endémique du Western Cape en Afrique du Sud et est présente de Malmesbury à Somerset West, Caledon et Elim.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height max0.2 m

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max324 m

Elevation min100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctotheca forbesiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEU846328.1 ↗646 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAATGACAACCGGGCGTCATGGGGATGGGCTCATACCCCCTACCCGTGGTGCCCT …

Arctotheca forbesiana isolate RM1215 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor22

Museum / vouchered20

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 16≤1 km 2>10 km 1

19 georeferenced · 3 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	14
Cape Town, ZA	3
Pretoria, ZA	2
South African National Biodiversity Institutelocation not on record	1

4 institutions · 20 of 20 vouchered records shown