Arctosa perita

(Latreille, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records5 886

Data sources9

Biological traits18

DNA specimens23

eDNA detections15

Sources9 archives

Databases and archives Arctosa perita's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 886 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University15 traits · 29 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements38 literature sources18 traits

Occurrence & distributionGBIF5 886 records

Environmental DNA1 datasets · 6 countries15 detections

DNA & barcodingBOLD23 specimens

01Narrative

Arctosa perita, also known as the sand bear spider, is a species of wolf spider in the family Lycosidae. They are native to Europe, North Africa, Turkey, the Caucasus, and Russia, however they have also been introduced into Canada. They live on dry, sandy soils or coastal dunes, where they create their burrows.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 38 sources

Pekár 2014aSchirmel et al. 2012Nature and Landscape Protection Act 2002Regulation 2000BartSchV 2005LGBl 2015LGBl 2007Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Bruun & Lissner 2019Liste France 2018Gajdoš & Svatoň 2001SLU 2020Staręga et al. 2001Witkowski et al. 2003Henriksen & Hilmo 2015Spuris et al. 1998Harvey et al. 2017Hyvärinen et al. 2019Komposch & Steinberger 1999Kielhorn 2017Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Maelfait et al. 1998Martin 2012Vangsgård et al. 1996Finch 2004Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Nentwig et al. 2018Dondale & Redner 1990Cardoso et al. 2011Pekár et al. 2012a

Morphometry3

Body length♀7.75·♂10 mm

Cephalothorax length♀3.19·♂3.21 mm

Cephalothorax width♀2.35·♂2.37 mm

Predation4

Hunting guildground hunters

Prey diversity3.69 mm

Simple hunting guild IIwanderer

Web buildingno

Ecology9

Ballooningvery common

Circadian activitydiurnal

Legal protectionYes

Light0.875 mm

Light 2open

Moisture 10.625 mm

Moisture 2very humid

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryCritically Endangered (1)

Defence2

Primary defenceCrypsis

Retreatground

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa perita has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections15

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

7Gmostly conserved

67Gmostly conserved

91Tmostly conserved

107Cmostly conserved

142Tmostly conserved

187Tmostly conserved

217Gmostly conserved

304Amostly conserved

529Amostly conserved

583Gmostly conserved

AACTTTGTATTTAATATTTGGAGTTTGGTCAGCTATAGCTGGAACTGGAATAAGAGTATTAATTCGGATAGAATTGGGGCATTCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes5

BIN1

Most divergent pair1.2%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa cinereasame genus9.0%Xerolycosa miniatasame family10.2%Xerolycosa nemoralissame family10.8%Oxyopes licentisame order11.6%Dolomedes sulfureussame order12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 886 records

Wild obs. + sensor5 393

Museum / vouchered490

Cultivated / captive2

Other1

Origin

Native38

Introduced59

Range

Area of Occupancy AOO9 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 1 322≤1 km 711≤10 km 2 425>10 km 44

4 502 georeferenced · 891 without coordinates

Open the mapobservation + sensor5 393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 156≤1 km 28≤10 km 161>10 km 9

354 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence490

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	106
Tilburg, NL	67
UAclocation not on record	59
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	43
Helsinki, FI	29
Copenhagen, DK	19
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
SLU Artdatabankenlocation not on record	8
	7
Frankfurt am Main	7
Uniwersytet w Białymstokulocation not on record	5
Bonn, DE	5
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	5
Tartu, EE	4
Natural History Museum, Londonlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	3
NTNU-VMlocation not on record	3
MZLUlocation not on record	3
Royal Museum for Central Africalocation not on record	2
ULLlocation not on record	2
South Kensington, GB	2
Departamento de Zoologia, Universidad de La Lagunalocation not on record	2
DFlocation not on record	1
Cambridge, US	1
Natural History Museum Rotterdamlocation not on record	1

25 institutions · 397 of 490 vouchered records shown · 93 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Arctosa perita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map6 countries0

Sand dunesOstseeufer, WeiÃdÃ¼ne im Ãbergang zu Bades…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 5.20–13.9

Seasonal swing summer↔winter12.7 °C

Max temp (day)11.8 °C 7.40–15.1

Min temp (night)6.60 °C -1.30–12.5

Precipitation83.1 mm/mo 39.1–130

Air humidity61.4 % 55.3–63.7

Moisture balance24.6 mm/mo

Vapour deficit452 Pa 352–614

Wind speed4.50 m/s

Cloud cover42.6 % 40.7–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctosa perita

At a glance

Sources9 archives

Morphometry3

Predation4

Ecology9

Defence2

At a glance

Record type5 886 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 886 records