Arctosa littoralis

(Hentz, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records3 365

Data sources9

Biological traits6

DNA specimens90

eDNA detections89

Sources9 archives

Databases and archives Arctosa littoralis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics90 specimens↗

World Spider Trait DBMasaryk University6 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF3 365 records

Environmental DNA1 datasets · 2 countries89 detections

DNA & barcodingBOLD90 specimens

01Narrative

Arctosa littoralis, the beach wolf spider, is a species of wolf spider in the family Lycosidae. It is found in North and Central America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aDondale & Redner 1990Pekár et al. 2012a

Morphometry3

Body length♀12.95·♂11.2 mm

Cephalothorax length♀6.08·♂6.06 mm

Cephalothorax width♀4.88·♂4.69 mm

Predation1

Prey diversity7.59 mm

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceCrypsis

05DNA & barcoding90 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa littoralis has left across the world's sequence archives.

At a glance

DNA specimens90

BINs3

Marker genes2

eDNA detections89

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus86 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

25Gmostly conserved

28Avariable

80Amostly conserved

88Gmostly conserved

100Gmostly conserved

124Gmostly conserved

130Cmostly conserved

145Gvariable

193Tmostly conserved

217Amostly conserved

244Gmostly conserved

295Amostly conserved

322Amostly conserved

340Tvariable

350Tmostly conserved

373Gmostly conserved

379Gmostly conserved

409Gmostly conserved

418Gmostly conserved

430Amostly conserved

472Gmostly conserved

475Avariable

517Amostly conserved

535Gmostly conserved

547Cmostly conserved

553Gmostly conserved

577Gmostly conserved

622Tmostly conserved

631Amostly conserved

643Gmostly conserved

AACTCTTTATTTAATGTTTGGTGTGTGATCTGCTATAGTTGGAACAGCTATAAGAGTATTAATTCGAATGGAGTTAGGTAATTCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes23

BINs3

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa virgosame genus9.8%Cupiennius chiapanensissame order10.3%Lobizon ojangurenisame family10.6%Rabidosa carranasame family11.2%Hippasa australissame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type3 365 records

Wild obs. + sensor3 237

Museum / vouchered128

Origin

Native5

Range

Area of Occupancy AOO9 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 867≤1 km 504≤10 km 175>10 km 189

2 735 georeferenced · 502 without coordinates

Open the mapobservation + sensor3 237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 12≤1 km 2≤10 km 8

22 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	36
Denver, US	36
Buenos Aires, AR	5
Mexico City, MX	5
Los Angeles, US	5
Saint John, CA	5
Chicago, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Chicago, US	4
San Francisco, US	3
Ohio State University Acarology Laboratorylocation not on record	3
Centre for Biodiversity Genomicslocation not on record	3
Cambridge, US	2
College Station, US	2
San Diego, US	1
Awka, NG	1
Edmonton, CA	1
Frankfurt am Main	1
Champaign, US	1

19 institutions · 123 of 128 vouchered records shown · 5 without an institution code

09Environmental DNA89 detections

Where the DNA of Arctosa littoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map2 countries0

BeachGrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.0 °C 17.7–28.0

Seasonal swing summer↔winter24.0 °C

Max temp (day)33.0 °C 24.5–33.0

Min temp (night)24.2 °C 13.0–24.2

Precipitation74.3 mm/mo 37.0–93.6

Air humidity55.2 % 50.2–56.0

Moisture balance-127 mm/mo -127–-97.2

Vapour deficit1,696 Pa 1,097–1,696

Wind speed4.00 m/s 2.50–4.00

Cloud cover27.3 % 24.7–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctosa littoralis

At a glance

Sources9 archives

Morphometry3

Predation1

Ecology1

Defence1

At a glance

Record type3 365 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 365 records