Arctornis rutila

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Arctornis

At a glance

Occurrence records84

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Arctornis rutila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Arctornis rutila is een donsvlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1781 door Fabricius.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctornis rutila has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

46Tmostly conserved

58Cvariable

59Cmostly conserved

67Avariable

70Tmostly conserved

73Amostly conserved

76Amostly conserved

85Cvariable

91Amostly conserved

92Tmostly conserved

94Amostly conserved

106Tmostly conserved

109Amostly conserved

115Cmostly conserved

118Tmostly conserved

154Cmostly conserved

157Cvariable

166Amostly conserved

196Amostly conserved

199Avariable

202Cmostly conserved

205Cvariable

214Amostly conserved

229Amostly conserved

232Tmostly conserved

256Tmostly conserved

266Cmostly conserved

277Cmostly conserved

278Cvariable

292Cmostly conserved

300Gmostly conserved

302Amostly conserved

313Cmostly conserved

337Tmostly conserved

340Tmostly conserved

364Cmostly conserved

373Amostly conserved

400Amostly conserved

433Amostly conserved

451Cmostly conserved

454Tmostly conserved

478Tmostly conserved

479Cmostly conserved

487Tmostly conserved

496Avariable

499Tmostly conserved

500Tmostly conserved

514Gvariable

520Amostly conserved

532Cmostly conserved

541Tmostly conserved

542Tmostly conserved

559Tmostly conserved

586Amostly conserved

595Tmostly conserved

613Cmostly conserved

622Gvariable

646Cmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTCTTAGACTCCTAATTCGAGCTGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.8%

Haplotypes4

BINs3

Most divergent pair7.4%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Depressaria ruticolasame order9.6%Niganda radialissame order9.6%Euclystis gorgesame family9.9%Depressaria gaalhaszleraesame order10.0%Polypogon tentaculariasame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor82

Museum / vouchered2

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 17≤1 km 33≤10 km 16>10 km 4

70 georeferenced · 12 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Arctornis rutila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.0–25.4

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.8 °C 28.5–28.8

Min temp (night)21.4 °C 20.7–21.9

Precipitation248 mm/mo 202–286

Air humidity68.4 % 64.8–71.0

Moisture balance98.8 mm/mo 63.6–164

Vapour deficit1,016 Pa 934–1,116

Wind speed1.20 m/s 1.00–1.30

Cloud cover62.8 % 35.8–72.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)