Arctornis flora

(Swinhoe, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Arctornis

At a glance

Occurrence records8

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Arctornis flora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Arctornis flora is een donsvlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Swinhoe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctornis flora has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes1

BIN1

Where individuals differ — all 14 variable positions, in barcode order

2Tvariable

7Cvariable

31Avariable

34Avariable

47Tvariable

118Cvariable

166Tvariable

178Avariable

232Cvariable

253Tvariable

268Avariable

397Tvariable

550Tvariable

616Cvariable

TTTATACTTTATTTTCGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ceromacra tymbersame family8.1%Cucullia sabulosasame order8.1%Rhesala fusiformissame family8.1%Cucullia amotasame order8.4%Mosopia eudoxusalissame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 records

Wild obs. + sensor8

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 5

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA3 detections

Where the DNA of Arctornis flora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.6–25.2

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.4 °C 28.0–28.8

Min temp (night)21.0 °C 20.3–21.0

Precipitation269 mm/mo 206–297

Air humidity64.9 % 64.5–66.5

Moisture balance127 mm/mo 66.5–142

Vapour deficit1,094 Pa 1,053–1,120

Wind speed1.20 m/s 1.20–1.30

Cloud cover29.3 % 26.3–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)