Arctogadus glacialis

(Peters, 1872) · species

image placeholder — illustration coming later

Animalia/Chordata/Gadiformes/Gadidae/Arctogadus

At a glance

Occurrence records1 622

Data sources11

Biological traits7

DNA specimens67

eDNA detections103

Sources11 archives

Databases and archives Arctogadus glacialis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility910 records↗

OBISOcean Biodiversity Information System712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 622 records

Environmental DNA1 datasets · 3 countries103 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT · NCBI≈634 Mbp

01Narrative

The East Siberian cod (Arctogadus borisovi) also known as the toothed cod, is an Arctic fish closely similar to the Arctic cod Arctogadus glacialis and also related to true cods (genus Gadus). It has been differentiated in appearance from the Arctic cod by having pronounced chin barbel. Their sides and back are dark olive and the belly are light grey with dark spots. They may grow up to 60 cm.Toothed cod, Arctogadus borisovi Canada's Polar Life Portal, University of Guelph (2002) Fishes attributed to East Siberian cod are found off the western half of the Canadian coast and the coasts of Siberia and also off northern and southern coasts of Greenland. The fish prefers living close to the sea floor at depths of 15 to 40 m, but it sometimes enters estuaries. They may also be found under pack ice. They are of little economic value. Newer research, based on both morphological and mitochondrial DNA data, has however concluded that the East Siberian cod is not a distinct species from the Arctic cod, but the genus Arctogadus comprises just a single species i.e. the Arctic cod Arctogadus glacialis.Jordan AD, Møller PR, Nielsen JG (2003) Revision of the Arctic cod genus Arctogadus. Journal of Fish Biology 62:1339–1352.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length32.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max1 000 m

Depth min0 m

Vulnerability22.5

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctogadus glacialis has left across the world's sequence archives.

At a glance

DNA specimens67

BINs1

Marker genes11

eDNA detections103

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P602 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

49Tmostly conserved

160Tmostly conserved

166Tmostly conserved

175Gmostly conserved

196Cmostly conserved

229Gmostly conserved

244Tmostly conserved

283Cmostly conserved

286Cmostly conserved

289Amostly conserved

319Gmostly conserved

334Amostly conserved

340Tmostly conserved

361Gmostly conserved

445Amostly conserved

460Amostly conserved

463Amostly conserved

481Tmostly conserved

496Cmostly conserved

499Amostly conserved

CCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTCCTTGGTGATGATCAAATTTATAATGTGATCGTTACAGCGCACGCTTTCGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes9

BIN1

Most divergent pair0.66%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Boreogadus saidasame family3.3%Gadus chalcogrammussame family3.7%Gadus macrocephalussame family3.8%Merlangius merlangussame family7.1%Melanogrammus aeglefinussame family8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_010122 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S rRNA16S rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arctogadus glacialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈633 902 253 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arctogadus glacialis0.63 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness33% BUSCO

07Deep time~0.02 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.02 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 622 records

Wild obs. + sensor1 161

Museum / vouchered461

Origin

Native2

Range

Area of Occupancy AOO1 892 km²

Depth

0–200 m sunlit14

200–1000 m twilight121

1–4 km midnight17

>4 km abyssal9

median 487.2 m · max 9 300 m · 161 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 7≤1 km 2>10 km 2

11 georeferenced · 1 150 without coordinates

Open the mapobservation + sensor1 161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤1 km 63>10 km 6

69 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence461

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	184
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	72
Bergen, NO	58
ArcODlocation not on record	9
Dalhousie Universitylocation not on record	4
Edmonton, CA	4
Cambridge, US	3
FishBaselocation not on record	2
Los Angeles, US	2
Zoologisches Museum Hamburglocation not on record	1
Wuzhou, CN	1
Stockholm, SE	1
Tromsø, NO	1
CASlocation not on record	1
Vancouver, CA	1
Toronto, CA	1
Maurice Lamontagne Institutelocation not on record	1

17 institutions · 346 of 461 vouchered records shown · 7 without an institution code

09Environmental DNA103 detections

Where the DNA of Arctogadus glacialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map3 countries0

Sea bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.30 °C -4.30–8.10

Seasonal swing summer↔winter28.8 °C

Max temp (day)8.30 °C -3.20–10.9

Min temp (night)4.70 °C -5.30–6.50

Precipitation80.4 mm/mo 19.8–83.5

Air humidity61.6 % 61.6–75.0

Moisture balance15.3 mm/mo

Vapour deficit348 Pa 134–416

Wind speed6.50 m/s

Cloud cover64.8 % 37.2–78.1

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctogadus glacialis

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type1 622 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 622 records