Arctocorisa germari

(Fieber, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Corixidae/Arctocorisa

At a glance

Occurrence records814

Data sources6

Biological traits1

DNA specimens8

eDNA detections1

Sources6 archives

Databases and archives Arctocorisa germari's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility814 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF814 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD8 specimens

01Narrative

Arctocorisa germari is a species of water boatman in the family Corixidae in the order Hemiptera.Tree of Life Web Project - Corixidae. 2005

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)saprophagous

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctocorisa germari has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

217Avariable

268Avariable

280Gvariable

433Avariable

AACACTATATTTCATTTTTGGTATTTGGTCAGGTATAGTTGGAACATCACTTAGATGATTAATTCGAATTGAATTAGGACAGCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cenocorixa bifidasame family5.9%Cenocorixa dakotensissame family7.1%Sigara mathesonisame family8.7%Sigara trilineatasame family9.0%Sigara mullettensissame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type814 records

Wild obs. + sensor593

Museum / vouchered218

Other3

Range

Area of Occupancy AOO1 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 409≤1 km 60≤10 km 83>10 km 1

553 georeferenced · 40 without coordinates

Open the mapobservation + sensor593

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 44≤1 km 56≤10 km 23

123 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanBIFlocation not on record	65
NTNU-VMlocation not on record	24
Nijmegen, NL	14
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
John May Museum of Natural Historylocation not on record	7
BioFokuslocation not on record	4
CBDClocation not on record	3
NHMOlocation not on record	3
Tilburg, NL	3
SLU Artdatabankenlocation not on record	2
Philadelphia, US	1
GMBRClocation not on record	1
South Kensington, GB	1
Natural History Museum, Londonlocation not on record	1

14 institutions · 136 of 218 vouchered records shown · 82 without an institution code

09Environmental DNA1 detections

Where the DNA of Arctocorisa germari was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)