Arctobius agelenoides

(Emerton, 1919) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Amaurobiidae/Arctobius

At a glance

Occurrence records181

Data sources8

Biological traits1

DNA specimens37

eDNA detections37

Sources8 archives

Databases and archives Arctobius agelenoides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility181 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

World Spider Trait DBMasaryk University1 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources1 traits

Occurrence & distributionGBIF181 records

Environmental DNA1 datasets · 3 countries37 detections

DNA & barcodingBOLD37 specimens

01Narrative

Arctobius is a genus of tangled nest spiders containing the single species, Arctobius agelenoides. It was first described by Pekka T. Lehtinen in 1967, with a holarctic distribution.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesHyvärinen et al. 2019Henriksen & Hilmo 2015SLU 2020

Ecology1

Regional IUCN Red List categoryNear Threatened (NT)

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctobius agelenoides has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections37

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

28Amostly conserved

118Cmostly conserved

GACTTTATATTTAATTTTTGGTGTTTGATCTGCTATAATTGGAACAGCTATGAGAATGTTGATTCGTGTGGAGTTAGGGCAACCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cicurina cicursame order13.2%Myrmarachne melanocephalasame order13.7%Diores youngaisame order13.8%Desis martensisame order14.0%Myrmarachne japonicasame order14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type181 records

Wild obs. + sensor11

Museum / vouchered170

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5≤10 km 1>10 km 2

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 90≤1 km 8≤10 km 2>10 km 10

110 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	96
University of Alberta Museums (UAM)location not on record	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Denver, US	6
Ciudad de México, MX	6
Ekaterinburg, RU	5
Helsinki, FI	3
Cambridge, US	2
Albuquerque, US	1
Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 143 of 170 vouchered records shown · 27 without an institution code

09Environmental DNA37 detections

Where the DNA of Arctobius agelenoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.1. Boreal ForestForestWetland4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C -13.2–15.4

Seasonal swing summer↔winter27.2 °C

Max temp (day)15.6 °C -9.20–21.5

Min temp (night)4.20 °C -17.1–10.8

Precipitation60.7 mm/mo 52.7–83.8

Air humidity58.1 % 55.8–67.8

Moisture balance-16.1 mm/mo -63.5–67.8

Vapour deficit512 Pa 72.2–758

Wind speed2.30 m/s 1.60–4.60

Cloud cover41.1 % 36.8–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)