Arctium minus
(Hill) Bernh. · speciesAt a glance
Occurrence records264 809
Data sources13
Biological traits58
DNA specimens69
eDNA detections41
Sources13 archives
Databases and archives Arctium minus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility264 809 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics69 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources58 traits
Chemical compositionLOTUS · NPASS120 compounds
Occurrence & distributionGBIF264 809 records
Environmental DNA1 datasets · 9 countries41 detections
DNA & barcodingBOLD · NCBI69 specimens
Genome at a glanceCCDB · GoaT · NCBI2.1 Gbp
01Narrative
La Grande Bardane (Arctium lappa L.), également appelée Bardane officinale ou Bardane commune, est une espèce de plante à fleurs herbacée annuelle ou bisannuelle de la famille des Astéracées. Elle possède de nombreuses propriétés favorables à la santé et constitue une plante traditionnelle des médecines populaires. Elle est également cultivée comme plante potagère pour sa racine consommée comme légume.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length5.6 mm
⚠ sources differ — AusTraits: 5.6 mm · GIFT: 7 mm
Leaf length100 mm
Leaf length max500 mm
Leaf mass4 105 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 117 000 mm² · GIFT: 117 000 mm²
Leaf width80 mm
⚠ sources differ — AusTraits: 80 mm · GIFT: 275 mm
Leaf width max275 mm
Leaf width min20 mm
Plant height0.975 m
⚠ sources differ — GIFT: 0.975 m · AusTraits: 1 m · LEDA: 0.7 m · TRY: 2 m
Plant height generative0.862 m
Plant height max3 m
Plant height min0.5 m
Seed length8 mm
Seed length max8 mm
Seed length min8 mm
Seed mass9.39 mg
⚠ sources differ — TRY: 9.39 mg · LEDA: 13.21 mg · GIFT: 10.59 mg
Seed mass max17.37 mg
Seed mass min5 mg
Life cycle & reproduction16
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flowering endSep
Flowering startJul
Flowering timeyyyyynnnnnny
Life formbiennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number11 600
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-biennial
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapewidely_ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio15.19 g/g
Leaf c445 mg/g
Leaf dry-matter content (LDMC)167 mg/g
⚠ sources differ — TRY: 167 mg/g · LEDA: 187 mg/g
Leaf n37.11 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)27.64 mm²/mg
⚠ sources differ — TRY: 27.64 mm²/mg · LEDA: 27.4 mm²/mg · GIFT: 24.07 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Seeds per fruit>1000
03Chemical composition120 compounds
Compounds documented for Arctium minus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Dibenzylbutyrolactone lignans $ Neolignans30
Oxygenated hydrocarbons11
Dibenzylbutyrolactone lignans10
Cinnamic acids and derivatives8
Fatty aldehydes7
Documented compounds120 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Secoisolariciresinol | present | LOTUS | |
| (+/-)-2-Hydroxypiperitone | present | LOTUS | |
| (-)-3,5-Dicaffeoyl quinic acid | present | LOTUS | |
| (-)-Arctigenin | present | LOTUS | |
| (-)-Arctiin | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (-)-Cyperene | present | LOTUS | |
| (-)-Dehydrocostus lactone | present | LOTUS | |
| (-)-Lariciresinol | present | LOTUS | |
| (-)-Matairesinol | present | LOTUS |
05DNA & barcoding69 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctium minus has left across the world's sequence archives.
At a glance
DNA specimens69
Marker genes10
GenBank sequences10
eDNA detections41
Countries10
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACACATC …
Arctium minus voucher MONT:87450 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL4★rbcLa★ITS3★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Arctium minus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 063 579 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arctium minus2.06 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records18–362n range36median36mode103records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3687×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — PAGNI A.M., CORSI G. - 1979. Cariologia di alcune specie d'interesse officinale della flora italiana.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 86: 465-473.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3846
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3847
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl — Huang, S. f., Y. q. Wang, Z. y. Chen & X. h. Shi. 1988. Plant chromosome counts (4). Subtrop. Forest Sci. Technol. 16: 25–30.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Ma, X. h., X. q. Ma & N. Li. 1990. Chromosome observation of some drug plants in Xinjiang. Acta Bot. Boreal.-Occid. Sin. 10: 203–210.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zheng, F. h. Xue, J. f. Yun, L. y. Wang & X. q. Fu. 1995. The chromosome numbers of 35 forage species and their geographical distribution. Grassl. China 1995(1): 16–20.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(7): 1117–1134.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 10. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 25: 8–9.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1988. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 1]. Ber. Bayer. Bot. Ges. 59: 13–22.
CCDB · ipcn-api-dl — Stepanov, N. V. 1992. Chromosome numbers in representatives of some families of higher plants. Bot. Žhurn. (Moscow & Leningrad) 77(2): 113–114.
CCDB · ipcn-api-dl — Stepanov, N. V. 1992. Chromosome numbers of some representatives of the families Apiaceae and Asteraceae from Krasnoyarsk region. Pp. 55–56 <in> Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-northern-plants — L. & L. 1944 b.
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-ipcn73-74 — KUZMANOV, B.A.,M.E., ANCHEV. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464
CCDB · book-ipcn73-74 — POGOSYAN, A. I. 1974. Chromosome numbers in some species of flower inl' plants from the flora of the Aragatz Mountain Massif. (in Russian) Tsitologiya i Genetika 8: 449-451. I
+31 more references
2n 3211×CCDB · book-northern-plants · CCDB · book-indian_vol1 · CCDB · eflora +2
CCDB · book-northern-plants — Sugiura 1936.
CCDB · book-northern-plants — Wulff 1937 h.
CCDB · book-indian_vol1 — Sugiura, T. 1931, 1936b ; Tischler, G. 1934; Rohweder, H. 1937
CCDB · eflora
CCDB · book-fedorov — Sugiura 1931, 1936b
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Wulff 1937b
CCDB · book-fedorov — Delay 1947
CCDB · book-atlas-flowering-plants — Wulff 1937b
CCDB · book-atlas-flowering-plants — Sugiura 1936
2n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mehra, P. N. (1976). Cytology of Himalayan Hardwoods. Sree Saraswaty Press Calcutta.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S., Nikolova, V. & Penceva, I. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 701-702.
CCDB · CromoCat 2015 — Valdes, B., J. Pastor & J. Ubera. (1978). In Numeros cromosomicos para la flora Espariola. 1-44. Lagascalia 7: 191–216.
2n 183×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 1-14. Valds, B., J. Pastor & J. Ubera.Lagascalia7(2): 192-197(1977).
CCDB · CromoCat 2015 — Astanova, S. B. (1989). Khromosomnye chisla predstavitelej slozhnocvetnykh flory Tadzhikistana. Pp. 89--90 in Tesizy II Symp. Plant Karyology
CCDB · CromoCat 2015 — Valdés, B., J. Pastor & J. Ubera. (1977). Números cromosómicos para la flora española, 1-14. Lagascalia 7(2): 192-197.
2n 342×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ge, C. j., Y. k. Li, P. Wan & P. s. Hsu. 1989. Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · CromoCat 2015 — Ge, C.-j., Li, Y.-k., Wan, P. & Hsu, P.-s. (1989). Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.
n 189×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · ipcn-api-dl — Valdes, B., J. Pastor & J. Ubera. 1978. In Numeros cromosomicos para la flora Espariola. 1-44. Lagascalia 7: 191–216.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Mehra, P. N. (1976). Cytology of Himalayan Hardwoods. Sree Saraswaty Press Calcutta.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S., Nikolova, V. & Penceva, I. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 701-702.
CCDB · CromoCat 2015 — Valdes, B., J. Pastor & J. Ubera. (1978). In Numeros cromosomicos para la flora Espariola. 1-44. Lagascalia 7: 191–216.
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Astanova, S. B. (1989). Khromosomnye chisla predstavitelej slozhnocvetnykh flory Tadzhikistana. Pp. 89--90 in Tesizy II Symp. Plant Karyology
CCDB · CromoCat 2015 — Probatova. (2006). Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. 91(7): 1117–1134.
CCDB · CromoCat 2015 — Krasnikov, A. A., Zhirova, O. S., Lomonosova, M. N. & Smirnov, S. V. (2003). Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. 88(9): 151–153.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S., Nikolova, V. & Penceva, I. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 701-702.
n 162×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 172×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
CCDB · iapt — IAPT/IOPB Chromosome Data 28
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.1% BUSCO
08Occurrence & distribution
Record type264 809 records
Wild obs. + sensor255 592
Museum / vouchered8 128
Cultivated / captive239
Other850
Origin
Native26 134
Introduced137
Range
Area of Occupancy AOO346 196 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 37 303≤1 km 59 450≤10 km 132 757>10 km 1 840
231 350 georeferenced · 24 242 without coordinates
Open the mapobservation + sensor255 592
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 1 024≤1 km 1 305≤10 km 2 085>10 km 254
4 668 georeferenced · 3 460 without coordinates
Open the institutions mapphysical evidence8 128
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 8>10 km 14
22 georeferenced · 217 without coordinates
Open the mapnot free-living239
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions185 of 326 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 632 |
| DBF-NHMDlocation not on record | 556 |
| LDlocation not on record | 367 |
| BFLlocation not on record | 277 |
| Philadelphia, US | 260 |
| BIO-UNIPIlocation not on record | 247 |
| Olocation not on record | 176 |
| Chongqing Museumlocation not on record | 159 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 147 |
| Madison, US | 123 |
| St. Paul, US | 122 |
| Moscow State Universitylocation not on record | 119 |
| SLU Artdatabankenlocation not on record | 118 |
| Turku, FI | 115 |
| Bronx, US | 115 |
| MeiseBGlocation not on record | 110 |
| Trondheim, NO | 107 |
| Christchurch, NZ | 101 |
| Uppsala, SE | 91 |
| KMNlocation not on record | 90 |
| Oskarshamn, SE | 88 |
| Wuzhou, CN | 85 |
| Tartu, EE | 84 |
| Salzburg, AT | 84 |
| Québec, CA | 75 |
| BRNUlocation not on record | 75 |
| Bergen, NO | 66 |
| Kuopio, FI | 65 |
| Oulu, FI | 64 |
| Bloomington, US | 63 |
| Uniwersytet Warszawskilocation not on record | 56 |
| Görlitz, DE | 52 |
| Ann Arbor, US | 51 |
| BDBClocation not on record | 48 |
| Entomological Society of Latvialocation not on record | 43 |
| Pullman, US | 42 |
| Barcelona, ES | 42 |
| Allentown, US | 41 |
| MAlocation not on record | 40 |
| BClocation not on record | 39 |
| University of New Hampshirelocation not on record | 39 |
| WTUlocation not on record | 37 |
| Bern, CH | 36 |
| South Kensington, GB | 36 |
| Acadia Universitylocation not on record | 36 |
| Adam Mickiewicz University in Poznańlocation not on record | 35 |
| Auckland, NZ | 34 |
| Denver, US | 34 |
| Saint Louis, US | 33 |
| Université Lavallocation not on record | 32 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 30 |
| Provincia di Livornolocation not on record | 30 |
| Burlington, US | 30 |
| University of Stellenboschlocation not on record | 29 |
| València, ES | 28 |
| Spearfish, US | 28 |
| Chadron, US | 28 |
| Mlocation not on record | 28 |
| Montréal, CA | 27 |
| Saint John, CA | 26 |
| New Haven, US | 25 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 25 |
| Vitoria, ES | 24 |
| Green Bay, US | 24 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 24 |
| Albuquerque, US | 23 |
| Hobart, AU | 23 |
| Jyväskylä, FI | 23 |
| Córdoba, AR | 22 |
| Vancouver, CA | 22 |
| Corvallis, US | 22 |
| Badajoz, ES | 22 |
| Williamsburg, US | 21 |
| GJOlocation not on record | 20 |
| Canadian Department of Agriculturelocation not on record | 20 |
| Moscow, US | 20 |
| Flagstaff, US | 20 |
| Salamanca, ES | 20 |
| WINlocation not on record | 19 |
| Berlin, DE | 17 |
| San Sebastián, ES | 17 |
| Wellington, NZ | 17 |
| College Park, US | 16 |
| Missoula, US | 16 |
| Bangkok, TH | 16 |
| Porto Alegre, BR | 15 |
| Toronto, CA | 15 |
| Granada, ES | 15 |
| TUR-Alocation not on record | 14 |
| Helsinki, FI | 14 |
| McWane Science Centerlocation not on record | 14 |
| Pamplona, ES | 13 |
| DOI/NPS, Greenbelt Parklocation not on record | 13 |
| Victoria, CA | 13 |
| Rotorua, NZ | 12 |
| Pocatello, US | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| University of Alberta Museumslocation not on record | 11 |
| Chapel Hill, US | 11 |
| Tallinn, EE | 11 |
| Riverside, US | 11 |
| Logan, US | 10 |
| Wlocation not on record | 10 |
| GZUlocation not on record | 10 |
| Porrentruy, CH | 10 |
| TROMlocation not on record | 10 |
| Morgantown, US | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Madrid, ES | 10 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 10 |
| Museo Achille Folettolocation not on record | 9 |
| Kew, GB | 9 |
| Frankfurt am Main | 9 |
| Karlsruhe, DE | 9 |
| Jaén, ES | 9 |
| IDElocation not on record | 9 |
| IFR-DNFlocation not on record | 9 |
| Museum of the Rockieslocation not on record | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| BSBIlocation not on record | 8 |
| Knoxville, US | 8 |
| Tilburg, NL | 8 |
| Blumenau, BR | 7 |
| ISAlocation not on record | 7 |
| San Isidro, AR | 7 |
| Grand Junction, US | 7 |
| San Luis Obispo, US | 7 |
| Hudson, US | 7 |
| Fayetteville, US | 7 |
| Caldwell, US | 7 |
| Whitewater, US | 6 |
| Henderson, US | 6 |
| Dekalb, US | 6 |
| Mississippi State, US | 6 |
| Bozeman, US | 6 |
| DASSHlocation not on record | 6 |
| University of Wisconsinlocation not on record | 6 |
| Phoenix, US | 6 |
| Boise, US | 6 |
| Pittsburg, US | 5 |
| Western Carolina Universitylocation not on record | 5 |
| Tacoma, US | 5 |
| Harrisonburg, US | 5 |
| Whitehorse, CA | 5 |
| Stockholm, SE | 5 |
| Minia, EG | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| SZUlocation not on record | 5 |
| Millersville, US | 5 |
| PRClocation not on record | 5 |
| Davenport, US | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Alicante, ES | 5 |
| Emporia, US | 4 |
| Paris, FR | 4 |
| Claremont, US | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| New Brunswick, US | 4 |
| UNESClocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Springfield, US | 4 |
| CJBGlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Chicago, US | 4 |
| Mount Annan, AU | 4 |
| Washington, US | 4 |
| Orem, US | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Provo, US | 4 |
| Appalachian State Universitylocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Gijón, ES | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Podgorica, ME | 4 |
| EL PASO, US | 4 |
| Sion, CH | 4 |
| Fairfax, US | 4 |
| EEZA-CSIClocation not on record | 4 |
| Weber State Universitylocation not on record | 4 |
| Porvoo, FI | 4 |
| Philadelphia, US | 4 |
| Forssa, FI | 4 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Philadelphia, US | 3 |
| Pamplona, ES | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| GAlocation not on record | 3 |
| Macomb, US | 3 |
| Anchorage, US | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| US | 3 |
| Clemson, US | 3 |
| ESP109location not on record | 3 |
| RJBJCIlocation not on record | 3 |
| Corrientes, AR | 3 |
| Maringá, BR | 3 |
| Arcata, US | 3 |
| Richmond, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Lincoln, US | 3 |
| San Diego, US | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| USFS/BHSClocation not on record | 3 |
| Davis, US | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Criciúma, BR | 3 |
| Mount Pleasant, US | 3 |
| Bandelier National Monumentlocation not on record | 2 |
| Universidade da Região de Joinville - Univillelocation not on record | 2 |
| Miami, US | 2 |
| Angwin, US | 2 |
| Santa Barbara, US | 2 |
| ASUlocation not on record | 2 |
| Johnson City, US | 2 |
| Beijing, CN | 2 |
| Namur, BE | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| FLADlocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Chicago, US | 2 |
| USFSlocation not on record | 2 |
| Jackson, US | 2 |
| Ashland, US | 2 |
| Kirksville, US | 2 |
| Durham, US | 2 |
| ROM007location not on record | 2 |
| Fort Worth, US | 2 |
| BGBMlocation not on record | 2 |
| Valparaiso, CL | 2 |
| FUNEDlocation not on record | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| JBAlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Bratislava, SK | 2 |
| Tuscaloosa, US | 2 |
| Kingston, US | 2 |
| Durango, US | 2 |
| ESP003location not on record | 2 |
| FUVATESlocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Fulda, DE | 1 |
| UNIVILLElocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Jefferson City, US | 1 |
| GB | 1 |
| H-AkrKGlocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| nbflocation not on record | 1 |
| UEMlocation not on record | 1 |
| Arequipa, PE | 1 |
| Dover, US | 1 |
| Bourges, FR | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Oswego, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Bothell, US | 1 |
| Waverly, US | 1 |
| Ypsilanti, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Long Beach, US | 1 |
| Dhaka, BD | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Portland, US | 1 |
| Glarus, CH | 1 |
| Pelotas, BR | 1 |
| Tromso University Museumlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Hamilton, US | 1 |
| H-Dunkellocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| UFMGlocation not on record | 1 |
| Brookings, US | 1 |
| QVMAGlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Cheney, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Staten Island, US | 1 |
| Norfolk, US | 1 |
| Northridge, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Madrid, ES | 1 |
| University of Wisconsinlocation not on record | 1 |
| CEPLAClocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Montréal, CA | 1 |
| Sant Julià de Lòria, AD | 1 |
| CJBNlocation not on record | 1 |
| Taipei, TW | 1 |
| Fargo, US | 1 |
| Xiamen, CN | 1 |
| Coimbra, PT | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Due West, US | 1 |
| UnBlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Göteborg, SE | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| University of British Columbialocation not on record | 1 |
| Córdoba, ES | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Austin, US | 1 |
| ESP004location not on record | 1 |
| Decorah, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Canberra, AU | 1 |
326 institutions · 7 316 of 8 128 vouchered records shown · 763 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA41 detections
Where the DNA of Arctium minus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found41
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 41 detections have coordinates
Open the map9 countries0
Dry grassland slope with Eurybia conspicua, …Phenology=FFL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 8.60–21.3
Seasonal swing summer↔winter19.6 °C
Max temp (day)19.6 °C 10.4–25.8
Min temp (night)12.3 °C 5.30–16.4
Precipitation72.2 mm/mo 51.6–95.0
Air humidity60.1 % 55.8–63.5
Moisture balance-21.9 mm/mo -97.9–14.3
Vapour deficit781 Pa 447–1,048
Wind speed3.00 m/s 2.30–4.80
Cloud cover40.9 % 36.5–52.6
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.