Arctium lappa
speciesAt a glance
Occurrence records135 528
Data sources11
Biological traits68
DNA specimens78
eDNA detections62
Sources11 archives
Databases and archives Arctium lappa's data was compiled from.
GBIFGlobal Biodiversity Information Facility135 528 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics78 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources68 traits
Chemical compositionFooDB · NPASS5 756 compounds
Occurrence & distributionGBIF135 528 records
Environmental DNA2 datasets · 9 countries62 detections
DNA & barcodingBOLD · NCBI78 specimens
Genome at a glanceGIFT · GoaT · NCBI2.6 Gbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length6.95 mm
⚠ sources differ — AusTraits: 6.95 mm · GIFT: 6.5 mm
Fruit length max7 mm
Fruit length min5 mm
Fruit width2.5 mm
Fruit width max3 mm
Fruit width min2 mm
Leaf length150 mm
⚠ sources differ — AusTraits: 150 mm · GIFT: 300 mm
Leaf length max500 mm
Leaf mass1 450 mg
Leaf size20 562 mm²
⚠ sources differ — TRY: 20 562 mm² · LEDA: 20 087 mm² · GIFT: 25 227 mm²
Leaf width100 mm
⚠ sources differ — AusTraits: 100 mm · GIFT: 27 mm
Leaf width max500 mm
Leaf width min30 mm
Plant height1.14 m
⚠ sources differ — GIFT: 1.14 m · AusTraits: 1.2 m · LEDA: 1.08 m · TRY: 1.33 m
Plant height generative1.38 m
Plant height max3 m
Plant height min0.6 m
Seed length6.5 mm
Seed length max6.5 mm
Seed length min6.5 mm
Seed mass10.81 mg
⚠ sources differ — TRY: 10.81 mg · LEDA: 12.31 mg · GIFT: 12.13 mg
Seed mass max13 mg
Seed mass min7.5 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endAug
Flowering startJul
Flowering timeyyyyynnnnnny
Life formperennial
Life spanbiennial
⚠ sources differ — TRY: biennial · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number12 388
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean2 125 m
Elevation min750 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTforest, meadows, mountains
Leaf compoundnesssimple
Leaf formcordate
Leaf shapewidely_ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf c448 mg/g
Leaf dry-matter content (LDMC)196 mg/g
Leaf n33.07 mg/g
Leaf p3.56 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)19.68 mm²/mg
⚠ sources differ — TRY: 19.68 mm²/mg · LEDA: 16.94 mm²/mg · GIFT: 17.28 mm²/mg
Wood density322 mg/cm³
Other traits5
Diaspore typegerminule
Leaf margintoothed
Leaf spinesno
Leaf thornsno
Monocarpymonocarp
03Chemical composition5 756 compounds
Compounds documented for Arctium lappa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids95
Glycerophospholipids57
Cinnamic acids and derivatives48
Purine nucleos(t)ides26
Dibenzylbutyrolactone lignans26
Documented compounds5 756 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Inulin | 30,000 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 11,385 mg/100g | FooDB | |
| Sugars | 3,550 mg/100g | FooDB | |
| Elaidic acid | 3,300 mg/100g | FooDB | |
| (-)-Arctiin | 3,000 mg/100g | FooDB | |
| Potassium | 994 mg/100g | FooDB | |
| alpha-Linolenic acid | 660 mg/100g | FooDB | |
| L-Aspartic acid | 531 mg/100g | FooDB | |
| L-Glutamic acid | 471 mg/100g | FooDB |
05DNA & barcoding78 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctium lappa has left across the world's sequence archives.
At a glance
DNA specimens78
Marker genes7
GenBank sequences10
eDNA detections62
Countries9
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCGACCACGCCTCCCCAGTGGGGATGCGTGTCGTTTTGGGGCGGAGACTGGTCTCCCGTGCCCATGGTGCGGTTGGCC …
Arctium lappa voucher XH-76 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceGIFT · GoaT · NCBI
The complete instruction manual Arctium lappa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 581 920 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arctium lappa2.58 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records32–362n range36median36mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 363×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
2n 321×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type135 528 records
Wild obs. + sensor127 668
Museum / vouchered7 000
Cultivated / captive146
Other714
Origin
Native391
Introduced3 550
Range
Area of Occupancy AOO212 752 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy31% within 1 km
≤100 m 16 982≤1 km 15 582≤10 km 69 864>10 km 1 359
103 787 georeferenced · 23 881 without coordinates
Open the mapobservation + sensor127 668
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 446≤1 km 830≤10 km 2 325>10 km 169
3 770 georeferenced · 3 230 without coordinates
Open the institutions mapphysical evidence7 000
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 3≤10 km 21>10 km 15
39 georeferenced · 107 without coordinates
Open the mapnot free-living146
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions162 of 308 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 772 |
| Beijing, CN | 362 |
| LDlocation not on record | 229 |
| Chengdu, CN | 200 |
| BFLlocation not on record | 170 |
| Uniwersytet Warszawskilocation not on record | 165 |
| Moscow State Universitylocation not on record | 162 |
| BIO-UNIPIlocation not on record | 159 |
| Yangling, CN | 158 |
| DBF-NHMDlocation not on record | 149 |
| Olocation not on record | 124 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 116 |
| SLU Artdatabankenlocation not on record | 107 |
| BRNUlocation not on record | 107 |
| South Kensington, GB | 100 |
| MeiseBGlocation not on record | 87 |
| Turku, FI | 87 |
| Kunming, CN | 86 |
| Uppsala, SE | 70 |
| Chengdu, CN | 65 |
| Wuhan, CN | 62 |
| Tartu, EE | 61 |
| Nanjing, CN | 58 |
| Guangzhou, CN | 53 |
| Salzburg, AT | 52 |
| Chongqing Museumlocation not on record | 51 |
| Oskarshamn, SE | 47 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 45 |
| Görlitz, DE | 42 |
| Burlington, US | 41 |
| Oulu, FI | 38 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| Bern, CH | 37 |
| WNNUlocation not on record | 36 |
| Provincia di Livornolocation not on record | 36 |
| Xining, CN | 35 |
| UGentlocation not on record | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 33 |
| Berlin, DE | 32 |
| Québec, CA | 28 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 26 |
| Bronx, US | 26 |
| IFR-DNFlocation not on record | 25 |
| Allentown, US | 24 |
| Mlocation not on record | 24 |
| Trondheim, NO | 24 |
| Philadelphia, US | 23 |
| University of New Hampshirelocation not on record | 21 |
| New Haven, US | 21 |
| GMBAlocation not on record | 20 |
| Karlsruhe, DE | 19 |
| Xian, CN | 17 |
| KMNlocation not on record | 17 |
| Montréal, CA | 17 |
| Guilin, CN | 16 |
| Madison, US | 15 |
| Bergen, NO | 15 |
| Otaru, JP | 14 |
| Shanxi Institute of Biologylocation not on record | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 14 |
| WINlocation not on record | 13 |
| QAUlocation not on record | 13 |
| Seoul, KR | 13 |
| Kuopio, FI | 12 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 12 |
| SXTCMlocation not on record | 12 |
| Tsukuba, JP | 11 |
| Wuhan, CN | 11 |
| Wlocation not on record | 11 |
| Nagano City, JP | 11 |
| Taipei, TW | 10 |
| Saint Louis, US | 10 |
| Zürich, CH | 10 |
| Christchurch, NZ | 10 |
| Zürich, CH | 10 |
| Nanjing, CN | 10 |
| BDBClocation not on record | 10 |
| Philadelphia, US | 9 |
| Museo Entomologico de Leonlocation not on record | 9 |
| BClocation not on record | 9 |
| Saint John, CA | 8 |
| Urumqi, CN | 8 |
| GJOlocation not on record | 8 |
| Guiyang, CN | 8 |
| San Luis Obispo, US | 7 |
| Spearfish, US | 7 |
| Kushiro City Museumlocation not on record | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Kew, GB | 7 |
| Shinshu Universitylocation not on record | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| Cambridge, US | 6 |
| Auckland, NZ | 6 |
| Zhengzhou, CN | 6 |
| Ann Arbor, US | 6 |
| Staten Island, US | 6 |
| Maringá, BR | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Bozeman, US | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Palacký University in Olomouclocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Porvoo, FI | 5 |
| CICYTEXlocation not on record | 5 |
| Podgorica, ME | 5 |
| BSBIlocation not on record | 5 |
| CASlocation not on record | 5 |
| Toronto, CA | 5 |
| Beijing Natural History Museumlocation not on record | 5 |
| Porto Alegre, BR | 5 |
| St. Paul, US | 5 |
| Hobart, AU | 5 |
| Jyväskylä, FI | 5 |
| Fulda, DE | 4 |
| Odawara, JP | 4 |
| Nanchong, CN | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Vancouver, CA | 4 |
| Université Lavallocation not on record | 4 |
| Wuzhou, CN | 4 |
| US | 4 |
| Chengdu, CN | 4 |
| BISHlocation not on record | 4 |
| Victoria, CA | 4 |
| WTUlocation not on record | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Dekalb, US | 4 |
| Bangkok, TH | 4 |
| Frankfurt am Main | 4 |
| GZUlocation not on record | 4 |
| Awka, NG | 4 |
| Urumqi, CN | 4 |
| Barcelona, ES | 4 |
| Central China Normal Universitylocation not on record | 3 |
| Pullman, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| KR | 3 |
| Salamanca, ES | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| Davenport, US | 3 |
| Sendai, JP | 3 |
| Changsha, CN | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| ENTClocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Porrentruy, CH | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Honolulu, US | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 3 |
| Taipei, TW | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| Edinburgh, GB | 3 |
| València, ES | 2 |
| Shenzhen, CN | 2 |
| IMMUlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Lanzhou, CN | 2 |
| Xian, CN | 2 |
| Parkville, AU | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Corvallis, US | 2 |
| Zhejiang Museum of Natural Historylocation not on record | 2 |
| Fort Worth, US | 2 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 2 |
| Canberra, AU | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Hudson, US | 2 |
| Pelotas, BR | 2 |
| TUR-Alocation not on record | 2 |
| UFOPlocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Toyama, JP | 2 |
| San Sebastián, ES | 2 |
| TROMlocation not on record | 2 |
| Brasília, BR | 2 |
| Chicago, US | 2 |
| Logan, US | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| HUFDlocation not on record | 2 |
| Claremont, US | 2 |
| DULlocation not on record | 2 |
| Whitewater, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Wellington, NZ | 2 |
| Shanghai, CN | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Minia, EG | 2 |
| PrivatHerblocation not on record | 2 |
| PRClocation not on record | 2 |
| UNESClocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| UEMlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Pamplona, ES | 2 |
| Kochi, JP | 2 |
| Chiba, JP | 2 |
| Paris, FR | 2 |
| Tallinn, EE | 2 |
| Bloomington, US | 2 |
| West China Subalpine Botanical Gardenlocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| College Park, US | 2 |
| Bourges, FR | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Kingston, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| INMAlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| UFBAlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| AZE014location not on record | 1 |
| Hamilton, US | 1 |
| Henderson, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Clemson, US | 1 |
| UoB-IBlocation not on record | 1 |
| Pamplona, ES | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Provo, US | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| München, DE | 1 |
| Tuscaloosa, US | 1 |
| nlocation not on record | 1 |
| Little Rock, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Jaén, ES | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Chongqing, CN | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Santa Teresa, BR | 1 |
| Criciúma, BR | 1 |
| sxphclocation not on record | 1 |
| Missoula, US | 1 |
| Zhuzhou, CN | 1 |
| Tilburg, NL | 1 |
| Tomioka, JP | 1 |
| Glarus, CH | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Flagstaff, US | 1 |
| Madrid, ES | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Shanghai, CN | 1 |
| Pondicherry, IN | 1 |
| Chinese Academy of Sciences, Xinjiang Institute of Ecology and Geography, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Sapporo, JP | 1 |
| Palmerston North, NZ | 1 |
| Adelaide, AU | 1 |
| Helsinki, FI | 1 |
| Namur, BE | 1 |
| Chicago, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Denver, US | 1 |
| Mount Annan, AU | 1 |
| KNFHClocation not on record | 1 |
| Vitoria, ES | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Sion, CH | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| ifplocation not on record | 1 |
| KIRMlocation not on record | 1 |
| Jackson, US | 1 |
| Stockholm, SE | 1 |
| CJBGlocation not on record | 1 |
| Northridge, US | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| FLADlocation not on record | 1 |
| New Brunswick, US | 1 |
| Arcata, US | 1 |
| nbflocation not on record | 1 |
| Sanda, JP | 1 |
| USP-IBlocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| MAlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Göteborg, SE | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Winterthur, CH | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
308 institutions · 6 507 of 7 000 vouchered records shown · 423 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA62 detections
Where the DNA of Arctium lappa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found62
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 62 detections have coordinates
Open the map9 countries0
wetland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.0 °C 10.0–19.4
Seasonal swing summer↔winter31.5 °C
Max temp (day)15.7 °C 13.6–22.9
Min temp (night)3.10 °C 3.10–15.3
Precipitation13.8 mm/mo 13.8–97.2
Air humidity45.7 % 45.7–64.7
Moisture balance-95.2 mm/mo -95.2–52.1
Vapour deficit827 Pa 479–896
Wind speed4.50 m/s 2.70–4.50
Cloud cover24.1 % 24.1–51.5
CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.