Arcte coerula

(Guenée, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Arcte

At a glance

Occurrence records2 181

Data sources7

Biological traits0

DNA specimens27

eDNA detections32

Sources7 archives

Databases and archives Arcte coerula's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 181 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 181 records

Environmental DNA1 datasets · 11 countries32 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceGoaT2n = 62

01Narrative

Arcte coerula, the ramie moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found from in south-east Asia, including Fiji, India, Sri Lanka, Myanmar, Japan, New Guinea, Taiwan and Norfolk Island. It has been recently observed in Hawaii, on the island of Maui.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcte coerula has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes2

eDNA detections32

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

76Gmostly conserved

82Cmostly conserved

205Cvariable

229Gmostly conserved

271Tmostly conserved

391Amostly conserved

400Cmostly conserved

401Tmostly conserved

433Amostly conserved

548Cmostly conserved

574Amostly conserved

581Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGTCTATTAATTCGTGCTGAATTGGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs2

Most divergent pair1.5%

AsiaOceaniaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Epitausa pronasame family7.0%Deltote bankianasame order8.2%Stilbia calberlaesame order8.4%Maliattha vialissame order8.5%Deltote deceptoriasame order8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_060666 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Arcte coerula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 181 records

Wild obs. + sensor1 800

Museum / vouchered381

Range

Area of Occupancy AOO4 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 441≤1 km 172≤10 km 71>10 km 157

841 georeferenced · 959 without coordinates

Open the mapobservation + sensor1 800

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 28≤10 km 1>10 km 1

30 georeferenced · 351 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	58
Taiwan Forestry Research Institutelocation not on record	57
Chiba, JP	41
Gifu prefectural Museumlocation not on record	33
Shiojiri City Museum of Natural Historylocation not on record	29
Hiwa Museum of Natural Historylocation not on record	28
FACTlocation not on record	23
Tomioka, JP	19
KOMlocation not on record	13
Kawasaki Shi Tama Ku, JP	11
KIRMlocation not on record	11
NSMKlocation not on record	11
RCMlocation not on record	9
JP	7
Iwate Prefectural Museumlocation not on record	5
National Institute of Biological Resourceslocation not on record	3
Sagamihara, JP	3
Itami Shi, JP	3
Australian National Insect Collectionlocation not on record	2
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Ishikawa Museum of Natural Historylocation not on record	1
Museums Victorialocation not on record	1
Toyama, JP	1
Zürich, CH	1
Bando, JP	1
Auckland, NZ	1

27 institutions · 376 of 381 vouchered records shown · 4 without an institution code

09Environmental DNA32 detections

Where the DNA of Arcte coerula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 16.4–26.2

Seasonal swing summer↔winter9.50 °C

Max temp (day)26.4 °C 19.6–29.1

Min temp (night)18.9 °C 12.1–22.6

Precipitation163 mm/mo 44.9–499

Air humidity67.7 % 60.1–75.1

Moisture balance13.3 mm/mo -62.5–403

Vapour deficit906 Pa 541–1,272

Wind speed1.40 m/s 1.20–2.60

Cloud cover46.4 % 25.3–66.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arcte coerula

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 181 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 181 records