Arcobara perlineata

(Schaus, 1913) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Arcobara

At a glance

Occurrence records9

Data sources5

Biological traits0

DNA specimens21

eDNA detections18

Sources5 archives

Databases and archives Arcobara perlineata's data was compiled from.

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD21 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcobara perlineata has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes4

eDNA detections18

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

88Gmostly conserved

313Tmostly conserved

370Gmostly conserved

586Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCCGGTATAATTGGAACCTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eois spnrsame family8.2%Idaea squamulatasame family8.4%Lacera procellosasame order8.5%Astygisa morosasame family8.7%Somatina triocellatasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PEF1-alphaMDH

animal barcodemarker

08Occurrence & distribution

Record type9 records

Wild obs. + sensor9

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 7≤1 km 1>10 km 1

9 georeferenced

Open the mapobservation + sensor9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA18 detections

Where the DNA of Arcobara perlineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 24.5–26.6

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.1 °C 26.4–28.7

Min temp (night)22.8 °C 22.2–24.8

Precipitation229 mm/mo 195–349

Air humidity72.2 % 67.5–73.9

Moisture balance66.3 mm/mo 65.8–196

Vapour deficit849 Pa 822–1,126

Wind speed3.60 m/s 1.90–3.60

Cloud cover30.7 % 29.9–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)