Arcobara multilineata

(Hulst, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Arcobara

At a glance

Occurrence records344

Data sources7

Biological traits0

DNA specimens13

eDNA detections14

Sources7 archives

Databases and archives Arcobara multilineata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility344 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF344 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Arcobara multilineata is a moth of the family Geometridae. It is found in south-eastern ArizonaBug Guide and Mexico.Moths of Mexico The length of the forewings is 10–12 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcobara multilineata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

214Avariable

217Avariable

262Gmostly conserved

370Amostly conserved

373Cmostly conserved

499Tmostly conserved

539Cmostly conserved

541Amostly conserved

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neohipparchus vallatasame family8.5%Xanthorhoe ibericasame family8.8%Idaea illustrissame family8.9%Problepsis centrophorasame family9.1%Thalassodes umbrimediasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type344 records

Wild obs. + sensor277

Museum / vouchered67

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 155≤1 km 36≤10 km 9>10 km 6

206 georeferenced · 71 without coordinates

Open the mapobservation + sensor277

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 1≤1 km 45≤10 km 6>10 km 1

53 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	43
Mississippi State, US	9
Colorado State Universitylocation not on record	9
New Haven, US	3
OSUClocation not on record	2
Cornell University Insect Collectionlocation not on record	1

6 institutions · 67 of 67 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Arcobara multilineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

Hill Country

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 16.7–27.0

Seasonal swing summer↔winter19.7 °C

Max temp (day)28.2 °C 23.8–32.7

Min temp (night)12.8 °C 10.2–21.7

Precipitation14.4 mm/mo 7.00–106

Air humidity39.3 % 37.0–51.6

Moisture balance-129 mm/mo -163–-59.5

Vapour deficit1,522 Pa 1,055–1,720

Wind speed2.20 m/s 1.70–3.10

Cloud cover24.8 % 17.0–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)