Arcitalitrus sylvaticus

(Haswell, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Arcitalitridae/Arcitalitrus

At a glance

Occurrence records204

Data sources7

Biological traits0

DNA specimens55

eDNA detections30

Sources7 archives

Databases and archives Arcitalitrus sylvaticus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF204 records

Environmental DNA1 datasets · 1 countries30 detections

DNA & barcodingBOLD55 specimens

01Narrative

Arcitalitrus sylvaticus, known generally as the lawn shrimp or landhopper, is a species of beach hopper in the family Talitridae. It is found in Australia and nearby areas of the Pacific but has been introduced to other places, like California, New Zealand, the British Isles, North Carolina and Florida. The first recorded instance in California was in 1967. They die in dry conditions and drown if it is too wet. In California, especially, they are a sign of overwatering, as they will leave their homes to avoid drowning.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcitalitrus sylvaticus has left across the world's sequence archives.

At a glance

DNA specimens55

BINs11

Marker genes2

eDNA detections30

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P544 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

11Cmostly conserved

25Cmostly conserved

34Tvariable

37Gvariable

70Tmostly conserved

115Tmostly conserved

145Cmostly conserved

161Gmostly conserved

193Gmostly conserved

199Amostly conserved

203Tmostly conserved

208Tmostly conserved

214Cmostly conserved

245Gmostly conserved

253Cvariable

280Avariable

310Gmostly conserved

320Gmostly conserved

323Cmostly conserved

352Gmostly conserved

370Gmostly conserved

373Cmostly conserved

418Avariable

430Gmostly conserved

448Gmostly conserved

449Tmostly conserved

460Tmostly conserved

469Cvariable

475Gmostly conserved

476Tmostly conserved

499Tvariable

503Gmostly conserved

523Gmostly conserved

CCGCTCTGAACTAAGAACTCCTGGCGCTGTAATTGGGAATGATCAAATTTACAATGTAGTAGTAACTGCTCATGCTTTTATTATAATTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 53 variants.

Diversity (π)2.4%

Haplotypes53

BINs11

Most divergent pair10.7%

OceaniaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type204 records

Wild obs. + sensor82

Museum / vouchered122

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 48≤1 km 10≤10 km 2>10 km 9

69 georeferenced · 13 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 8≤1 km 2≤10 km 47>10 km 7

64 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	32
Sydney, AU	31
QVMAGlocation not on record	26
Natick, US	16
New Haven, US	6
Cambridge, US	5
DPIlocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	1
San Francisco, US	1
Frankfurt am Main	1

10 institutions · 122 of 122 vouchered records shown

09Environmental DNA30 detections

Where the DNA of Arcitalitrus sylvaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)