Archontophoenix tuckeri

Dowe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Archontophoenix

At a glance

Occurrence records96

Data sources8

Biological traits33

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Archontophoenix tuckeri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Archontophoenix tuckeri, the Rocky River palm or Cape York palm, is a palm native to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length20 mm

Fruit length max25 mm

Fruit length min15 mm

Fruit width12.5 mm

Fruit width max15 mm

Fruit width min10 mm

Leaf length3 150 mm

Leaf length max3 150 mm

Plant height20 m

Seed length9 mm

Seed width9 mm

Life cycle & reproduction5

Flowering timeyynnnyyyyyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Other traits6

Dbh max26 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archontophoenix tuckeri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ634511.1 ↗362 bp

ACGT

TCGAGGGCACGTTTGCCTGGGCATCACATGAAAATCGATGCTCCGCTCCCCCCTGGACCATGATGGGCTTCGGGGTGGCCGGATGCGGAC …

Archontophoenix tuckeri voucher MBC 96322B (K) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type96 records

Wild obs. + sensor13

Museum / vouchered81

Other2

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 12 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 11≤1 km 5≤10 km 13>10 km 1

30 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	61
Brisbane, AU	15
James Cook Townsvillelocation not on record	4

3 institutions · 80 of 81 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Archontophoenix tuckeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–11.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C

Min temp (night)7.30 °C

Precipitation76.5 mm/mo

Air humidity62.5 %

Moisture balance-8.00 mm/mo

Vapour deficit552 Pa

Wind speed4.60 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)