Archontophoenix myolensis

Dowe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Archontophoenix

At a glance

Occurrence records30

Data sources9

Biological traits33

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Archontophoenix myolensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Archontophoenix myolensis, the Myola palm, is a species of flowering plant in the family Arecaceae. It is endemic to Queensland, Australia. It is threatened by habitat loss. It occurs in the Myola area and the Black Mountain in the Kuranda range in the Atherton Tablelands, Queensland. The total population is seriously threatened by habitat clearance and is estimated to contain fewer than 100 mature trees and remains unprotected. Regeneration is good.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length17.5 mm

Fruit length max21 mm

Fruit length min13 mm

Fruit width11 mm

Fruit width max12 mm

Fruit width min10 mm

Leaf length4 000 mm

Leaf length max4 000 mm

Plant height20 m

Seed length17 mm

Seed width8.75 mm

Life cycle & reproduction5

Flowering timennnnyyynnnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Other traits6

Dbh max30 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archontophoenix myolensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ634510.1 ↗370 bp

ACGT

CCGAGGGCACGCCTGCCTGGGCATCATGCAAAAAGTGATGCTCCGCTTCCCCCGGAGCCATGATGGGCTTCGGGGTGGTTGGATGTAGAC …

Archontophoenix myolensis voucher MBC 9665F (K) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor12

Museum / vouchered17

Other1

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 12

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16

16 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	14
Brisbane, AU	2

2 institutions · 16 of 17 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Archontophoenix myolensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–11.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C

Min temp (night)7.30 °C

Precipitation76.5 mm/mo

Air humidity62.5 %

Moisture balance-8.00 mm/mo

Vapour deficit552 Pa

Wind speed4.60 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)