Archontophoenix cunninghamiana

(H.Wendl.) H.Wendl. & Drude · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Archontophoenix

At a glance

Occurrence records5 892

Data sources10

Biological traits51

DNA specimens20

eDNA detections9

Sources10 archives

Databases and archives Archontophoenix cunninghamiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 892 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Occurrence & distributionGBIF5 892 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Archontophoenix cunninghamiana ou palmiste de Cunningham est une espèce de palmier du genre Archontophoenix et de la famille des Arecaceae, originaire de l'est de l'Australie. Ce petit palmier est largement cultivé dans les parcs et jardins tropicaux.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology21

Fruit length15 mm

⚠ sources differ — AusTraits: 15 mm · GIFT: 12.5 mm

Fruit length max15 mm

Fruit length min10 mm

Fruit width12 mm

⚠ sources differ — AusTraits: 12 mm · GIFT: 11 mm

Fruit width max15 mm

Leaf length600 mm

Leaf length max4 500 mm

Leaf length min3 000 mm

Leaf mass793 mg

Leaf mass per area86.03 g/m2

Leaf size9 081 mm²

Leaf width29.3 mm

Leaf width max80 mm

Leaf width min30 mm

Petiole length2.25 cm

Plant height25 m

⚠ sources differ — AusTraits: 25 m · TRY: 16 m

Plant height max15 m

Plant height min0.2 m

Seed length9 mm

Seed mass568 mg

Seed width9 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennyyynnnnnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 700 m

Elevation min500 m

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: palmoid · TRY: Palm

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)11.62 mm²/mg

Wood density827 mg/cm³

Other traits5

Dbh max30 cm

Defenseno

Leaf spinesno

Shoot length max3 000 cm

Shoot orientationerect

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archontophoenix cunninghamiana has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes8

GenBank sequences10

eDNA detections9

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP663315.1 ↗332 bpAustralia · 2022

ACGT

ATCGAGTCTTTGAATGCAAGTTGTGCCCGAGGCCACCGGGTCGAGGGCACGCCTGCCTGGGCATCATGCGTAAATCGATGCTTCACTCCC …

Archontophoenix cunninghamiana isolate 3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS2rpL32-trnLrps16-trnK

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Archontophoenix cunninghamiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records28–322n range30median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · book-fedorov · CCDB · Cave1957

CCDB · book-fedorov — Eichhorn 1957

CCDB · Cave1957 — Eichhorn

2n 322×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Röser, M., M. A. T. Johnson & L. Hanson. 1997. Nuclear DNA amounts in palms (Arecaceae). Bot. Acta 110: 79–89.

CCDB · kew — Röser M, Johnson MAT, Hanson L. 1997. Nuclear DNA amounts in palms (Arecaceae). Botanica Acta 110: 79-89.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 892 records

Wild obs. + sensor5 249

Museum / vouchered221

Cultivated / captive10

Other412

Origin

Native5

Introduced47

Range

Area of Occupancy AOO8 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 4 379≤1 km 396≤10 km 53>10 km 50

4 878 georeferenced · 371 without coordinates

Open the mapobservation + sensor5 249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 31≤1 km 36≤10 km 30>10 km 19

116 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence221

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 3≤10 km 2

7 georeferenced · 3 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	53
Brisbane, AU	34
Smithfield, AU	31
Museo Entomologico de Leonlocation not on record	19
Canberra, AU	17
Campo Mourão, BR	9
Armidale, AU	6
Mount Annan, AU	5
UTFPR-CPlocation not on record	3
Lake Charles, US	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
USP-IBlocation not on record	3
Universidad Nacional de Colombia (UNAL)location not on record	3
Rotorua, NZ	2
UFMGlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Universidade Federal do Rio Grande do Sullocation not on record	2
Henry Brockhouse Collectionlocation not on record	2
Cape Town, ZA	1
Foz do Iguaçu, BR	1
Sanda, JP	1
FUNEDlocation not on record	1
Long Beach, US	1
Christchurch, NZ	1
JBRJlocation not on record	1
UFPRlocation not on record	1
Miami, US	1
Santa Barbara, US	1
Londrina, BR	1
John T. Waterhouse Herbariumlocation not on record	1
Cenargenlocation not on record	1
Adelaide, AU	1
Pretoria, ZA	1
Durban, ZA	1
Brasília, BR	1
Bronx, US	1

36 institutions · 217 of 221 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Archontophoenix cunninghamiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 8.50–25.1

Seasonal swing summer↔winter9.80 °C

Max temp (day)23.3 °C 12.2–30.2

Min temp (night)16.2 °C 4.30–21.3

Precipitation135 mm/mo 103–164

Air humidity62.6 % 59.9–64.0

Moisture balance24.7 mm/mo 2.80–43.6

Vapour deficit916 Pa 455–1,154

Wind speed2.80 m/s 1.10–5.30

Cloud cover40.4 % 25.7–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archontophoenix cunninghamiana

At a glance

Sources10 archives

Size & morphology21

Life cycle & reproduction8

Diet & foraging1

Habitat & environment13

Physiology & chemistry3

Other traits5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 892 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 892 records