Archontophoenix alexandrae

(F.Muell.) H.Wendl. & Drude · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Archontophoenix

At a glance

Occurrence records869

Data sources14

Biological traits50

DNA specimens11

eDNA detections7

Sources14 archives

Databases and archives Archontophoenix alexandrae's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility869 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources50 traits

Chemical compositionLOTUS21 compounds

Occurrence & distributionGBIF869 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB · GIFT2n = 32

01Narrative

Archontophoenix alexandrae, commonly known as Alexandra palm, king palm, Northern Bangalow palm, or feather palm, is a palm endemic to Queensland, Australia. It was named in honour of Princess Alexandra of Denmark, but is also often referred to as Alexander palm (note the difference in gender of the names).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length11 mm

⚠ sources differ — AusTraits: 11 mm · GIFT: 12.17 mm

Fruit length max14 mm

Fruit length min8 mm

Fruit width8.5 mm

⚠ sources differ — AusTraits: 8.5 mm · GIFT: 10 mm

Fruit width max11 mm

Fruit width min6 mm

Leaf length4 500 mm

Leaf length max4 500 mm

Leaf mass per area53.5 g/m2

Leaf size13 250 mm²

Leaf width max800 mm

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · AusTraits: 30 m · TRY: 25 m

Plant height max30 m

Plant height min10 m

Seed length8 mm

Seed mass316 mg

⚠ sources differ — TRY: 316 mg · AusTraits: 283 mg

Seed width8 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyyynnnnnn

Life formtree

Life spanperennial

Pollination syndromebeetle

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation min500 m

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density827 mg/cm³

Other traits6

Dbh max30 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max3 000 cm

Shoot orientationerect

03Chemical composition21 compounds

Compounds documented for Archontophoenix alexandrae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aminoacids20

Aminoacids $ Dipeptides1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Valine	present	LOTUS
(2R)-2-azaniumyl-3-phenylpropanoate	present	LOTUS
(2S)-2-(phenylazaniumyl)propanoate	present	LOTUS
(2S)-2-ammonio-3-(1H-imidazol-4-yl)propanoate	present	LOTUS
(2S)-2-ammonio-3-(4-hydroxyphenyl)propanoate	present	LOTUS
(2S,3S)-2-ammonio-3-methylpentanoate	present	LOTUS
Arginine	present	LOTUS
d,l-Serine	present	LOTUS
D-Alanine	present	LOTUS
D-Aspartic acid	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archontophoenix alexandrae has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes6

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK692162.1 ↗473 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGC …

Archontophoenix alexandrae voucher XTBG038 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GIFT

The complete instruction manual Archontophoenix alexandrae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records28–322n range30median32mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · book-fedorov · CCDB · Cave1957 · GIFT · GIFT (floras)

CCDB · book-fedorov — Eichhorn 1957

CCDB · Cave1957 — Eichhorn

GIFT · GIFT (floras)

2n 323×CCDB · ipcn-api-dl · CCDB · book-fedorov · GIFT · GIFT (floras)

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-fedorov — Read 1965b

GIFT · GIFT (floras)

n 161×CCDB · book-ipcn65

CCDB · book-ipcn65 — Read 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type869 records

Wild obs. + sensor458

Museum / vouchered232

Cultivated / captive1

Other178

Origin

Native6

Introduced141

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 270≤1 km 77≤10 km 12>10 km 15

374 georeferenced · 84 without coordinates

Open the mapobservation + sensor458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 13≤1 km 9≤10 km 59>10 km 25

106 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence232

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	77
Museo Entomologico de Leonlocation not on record	43
Brisbane, AU	29
Canberra, AU	19
Bronx, US	9
Universidad de Caldas (UCaldas)location not on record	8
Mount Annan, AU	6
James Cook Townsvillelocation not on record	5
Miami, US	4
Honolulu, US	3
Kew, GB	2
ASUlocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
Australian Tropical Herbariumlocation not on record	2
Beijing, CN	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Guilin, CN	1
Paris, FR	1
USP-IBlocation not on record	1
Auckland, NZ	1
BISHlocation not on record	1
Ojo, NG	1
EL PASO, US	1
Criciúma, BR	1
Adelaide, AU	1
LDlocation not on record	1
HUAlocation not on record	1
UNESClocation not on record	1

28 institutions · 225 of 232 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Archontophoenix alexandrae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 16.6–26.8

Seasonal swing summer↔winter9.20 °C

Max temp (day)27.6 °C 20.9–28.1

Min temp (night)20.4 °C 11.1–25.6

Precipitation110 mm/mo 32.8–271

Air humidity63.1 % 47.9–65.0

Vapour deficit1,229 Pa 877–1,455

Cloud cover41.3 % 22.8–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)