Archonias nimbice

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Archonias

At a glance

Occurrence records2 310

Data sources3

Biological traits0

DNA specimens4

eDNA detections0

Sources3 archives

Databases and archives Archonias nimbice's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 310 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 310 records

DNA & barcodingBOLD4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archonias nimbice has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes1

BINs2

Where individuals differ — all 14 variable positions, in barcode order

22Gmostly conserved

88Tmostly conserved

100Tmostly conserved

163Gmostly conserved

190Gmostly conserved

313Cmostly conserved

331Amostly conserved

337Cmostly conserved

358Cmostly conserved

466Gmostly conserved

478Cmostly conserved

508Amostly conserved

589Tmostly conserved

640Tmostly conserved

AACTTTATACTTTATTTTTGGGGTCTGATCCGGACTAATCGGAACTTCCTTAAGATTATTAATTCGAACTGAACTAGGAAACCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archonias melanisasame genus8.4%Archonias smallisame genus9.9%Archonias approximatasame genus10.4%Archonias reductasame genus12.9%Zegris euphemesame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 310 records

Wild obs. + sensor2 305

Museum / vouchered5

Range

Area of Occupancy AOO4 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 966≤1 km 462≤10 km 213>10 km 86

1 727 georeferenced · 578 without coordinates

Open the mapobservation + sensor2 305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad del Valle de Guatemalalocation not on record	4
University Park, US	1

2 institutions · 5 of 5 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archonias nimbice

At a glance

Sources3 archives

At a glance

Record type2 310 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Record type2 310 records