Archivesica gigas

(Dall, 1896) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Venerida/Vesicomyidae/Archivesica

At a glance

Occurrence records391

Data sources8

Biological traits3

DNA specimens146

eDNA detections165

Sources8 archives

Databases and archives Archivesica gigas's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility376 records↗

OBISOcean Biodiversity Information System15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI165 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics146 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS391 records

Environmental DNA2 datasets · 4 countries165 detections

DNA & barcodingBOLD146 specimens

01Narrative

Archivesica gigas is een tweekleppigensoort uit de familie van de Vesicomyidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1896 door Dall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min1 567 m

05DNA & barcoding146 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archivesica gigas has left across the world's sequence archives.

At a glance

DNA specimens146

BINs2

Marker genes2

eDNA detections165

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P480 bp consensus141 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

1Gmostly conserved

7Gmostly conserved

8Amostly conserved

9Gmostly conserved

11Tmostly conserved

12Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Gmostly conserved

17Gmostly conserved

114Cmostly conserved

233Gmostly conserved

GTGCTGGAGTTTTAGGGGATAGCCATTTGTACCAGGTAGTGGTAACTGCCCATGGGTTGTTAATAATTTTCTTTTTGGTAATACCTATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes3

BINs2

Most divergent pair1.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calyptogena extentasame family6.3%Archivesica diagonalissame genus6.5%Archivesica puertodeseadoisame genus6.9%Phreagena soyoaesame family8.6%Phreagena okutaniisame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type391 records

Wild obs. + sensor6

Museum / vouchered375

Other10

Range

Area of Occupancy AOO248 km²

Depth

0–200 m sunlit0

200–1000 m twilight2

1–4 km midnight13

>4 km abyssal0

median 1 592.6 m · max 2 450 m · 15 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	226
Santa Barbara Museum of Natural Historylocation not on record	53
Chicago, US	4
Los Angeles, US	3
Frankfurt am Main	2
Cambridge, US	1

6 institutions · 289 of 375 vouchered records shown · 80 without an institution code

09Environmental DNA165 detections

Where the DNA of Archivesica gigas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found165

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 165 detections have coordinates

Open the map4 countries0

Pacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 12.5–28.9

Seasonal swing summer↔winter12.2 °C

Max temp (day)28.1 °C 13.2–29.6

Min temp (night)26.4 °C 11.9–28.2

Precipitation19.8 mm/mo 0.4–90.1

Air humidity66.7 % 63.0–73.1

Vapour deficit1,272 Pa 444–1,323

Cloud cover21.2 % 10.1–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 142 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)