Archips xylosteana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records35 906

Data sources10

Biological traits2

DNA specimens115

eDNA detections233

Sources10 archives

Databases and archives Archips xylosteana's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI233 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF35 906 records

Environmental DNA4 datasets · 20 countries233 detections

DNA & barcodingBOLD115 specimens

Genome at a glanceGoaT · NCBI≈651 Mbp

01Narrative

Archips xylosteana, the variegated golden tortrix or brown oak tortrix, is a moth of the family Tortricidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips xylosteana has left across the world's sequence archives.

At a glance

DNA specimens115

BINs2

Marker genes1

eDNA detections233

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus107 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

79Amostly conserved

85Tmostly conserved

160Amostly conserved

214Amostly conserved

286Tmostly conserved

364Tmostly conserved

379Gmostly conserved

475Cmostly conserved

481Amostly conserved

619Avariable

CACATTATATTTTATCTTTGGAATTTGAGCTGGTATAGTAGGAACCTCATTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes22

BINs2

Most divergent pair1.4%

EuropeAfricaOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips rosanasame genus4.0%Archips crataeganasame genus4.0%Archips magnolianasame genus5.5%Archips argyrospilasame genus5.5%Archips mortuanasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Archips xylosteana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈650 594 549 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Archips xylosteana0.65 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.4% BUSCO

08Occurrence & distribution

Record type35 906 records

Wild obs. + sensor34 324

Museum / vouchered1 491

Other91

Origin

Native64

Range

Area of Occupancy AOO23 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 5 941≤1 km 2 360≤10 km 22 253>10 km 46

30 600 georeferenced · 3 724 without coordinates

Open the mapobservation + sensor34 324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 729≤1 km 231≤10 km 112

1 072 georeferenced · 419 without coordinates

Open the institutions mapphysical evidence1 491

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	539
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	191
NTNU-VMlocation not on record	135
NHMOlocation not on record	108
Provincia di Livornolocation not on record	72
SLU Artdatabankenlocation not on record	61
Tartu, EE	58
Philadelphia, US	38
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	37
Nijmegen, NL	36
Stockholm, SE	24
Natural History Museum Rotterdamlocation not on record	18
DABUHlocation not on record	17
Muzeum Górnośląskie w Bytomiulocation not on record	13
CBDClocation not on record	11
Iwate Prefectural Museumlocation not on record	7
Kuopio, FI	7
KIRMlocation not on record	6
Salzburg, AT	6
European Distributed Institute of Taxonomy (EDIT)location not on record	5
BioFokuslocation not on record	5
Zürich, CH	5
University of Kaiserslauternlocation not on record	5
Brussels, BE	3
Uniwersytet Łódzkilocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	3
Hiwa Museum of Natural Historylocation not on record	3
ZSMlocation not on record	3
Sagamihara, JP	2
NMBU:MINAlocation not on record	2
San Francisco, US	2
Tallinn, EE	2
Research Collection of Hartmut Wegnerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Extremaduralocation not on record	1
Chiba Universitylocation not on record	1
RCMlocation not on record	1
Colorado State Universitylocation not on record	1
University of Ostravalocation not on record	1
Bando, JP	1
KOMlocation not on record	1
MZLUlocation not on record	1
Radicondoli, IT	1
South Kensington, GB	1
Rovaniemi, FI	1

45 institutions · 1 440 of 1 491 vouchered records shown · 51 without an institution code

09Environmental DNA233 detections

Where the DNA of Archips xylosteana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found233

Studies independent surveys4

Countries20

Verifiable raw sequence linked87

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 233 detections have coordinates

Open the map20 countries0

1.1. Boreal Forest|1. Forest & Woodlandinside forestjuniperus forestmeadowsnatural woodlanddry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.2–20.5

Seasonal swing summer↔winter17.4 °C

Max temp (day)18.6 °C 15.4–24.6

Min temp (night)10.9 °C 7.20–15.9

Precipitation64.5 mm/mo 39.3–86.1

Air humidity58.7 % 54.4–61.0

Moisture balance-53.9 mm/mo -82.3–-31.0

Vapour deficit689 Pa 548–1,078

Wind speed3.20 m/s 2.00–4.30

Cloud cover39.7 % 33.9–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 229 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archips xylosteana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type35 906 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type35 906 records