Archips fuscocupreanus

Walsingham, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records59

Data sources8

Biological traits0

DNA specimens29

eDNA detections30

Sources8 archives

Databases and archives Archips fuscocupreanus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD29 specimens

01Narrative

Archips fuscocupreanus, the exotic leafroller moth or apple tortrix, is a species of moth of the family Tortricidae. It is found in China (Heilongjiang, Liaoning), South Korea, Japan and Russia (Primorye, Kuril Islands). It is an introduced species in the north-eastern United States, where it has been recorded from Connecticut, Massachusetts, New Jersey, New York and Rhode Island. It has also been recorded from Washington.TortAI The wingspan is 16–22 mm for males and 20–24 mm for females.Japanese Moths Adults have been recorded on wing from June to July in China. The larvae feed on Acer, Alnus, Betula, Castanea, Diospyros, Erigeron, Fragaria, Glycine, Juglans, Malus, Morus, Phaseolus, Prunus, Pyrus, Quercus, Rosa, Rubus, Salix, Sorbus and Ulmus species.Revision of Tribe Archipini (Tortricidae: Tortricinae) in Northeast China

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips fuscocupreanus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 7 variable positions, in barcode order

160Gvariable

211Gvariable

364Cvariable

466Avariable

533Cvariable

583Gvariable

586Avariable

TACGTTATATTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips crataeganasame genus6.4%Archips goyeranasame genus6.7%Archips argyrospilasame genus6.7%Archips myricanasame genus6.8%Archips mortuanasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type59 records

Wild obs. + sensor22

Museum / vouchered37

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 2

8 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KCMNlocation not on record	9
Hiwa Museum of Natural Historylocation not on record	6
St. Paul, US	6
Iwate Prefectural Museumlocation not on record	4
Ishikawa Museum of Natural Historylocation not on record	2
KIRMlocation not on record	2
KOMlocation not on record	2
Kawasaki Shi Tama Ku, JP	2
HUNMlocation not on record	1
Chiba, JP	1
Washington State Department of Agriculturelocation not on record	1
RCMlocation not on record	1

12 institutions · 37 of 37 vouchered records shown

09Environmental DNA30 detections

Where the DNA of Archips fuscocupreanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 9.70–16.2

Seasonal swing summer↔winter10.1 °C

Max temp (day)21.0 °C 12.4–21.9

Min temp (night)12.2 °C 6.20–12.8

Precipitation42.2 mm/mo 34.8–159

Air humidity64.0 % 64.0–64.8

Moisture balance-85.2 mm/mo -107–84.6

Vapour deficit644 Pa 400–644

Wind speed3.90 m/s 2.40–4.20

Cloud cover31.0 % 29.9–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)