Archilestes californicus

McLachlan, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Lestidae/Archilestes

At a glance

Occurrence records1 906

Data sources8

Biological traits0

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Archilestes californicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 906 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Archilestes californicus, the California spreadwing, is a species of spreadwing in the damselfly family Lestidae. It is found in Central America and North America. The IUCN conservation status of Archilestes californicus is "LC", least concern, with no immediate threat to the species' survival. The population is increasing. The IUCN status was reviewed in 2017.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archilestes californicus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P179 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs0

Most divergent pair3.4%

Where individuals differ — all 6 variable positions, in barcode order

19Tvariable

100Cvariable

103Tvariable

106Tvariable

169Tvariable

178Tvariable

TACACTGTACTTAATGTTTGGGGCATGAGCAGGAATAGTAGGGACAGCACTAAGTATACTTATTCGTGTAGAACTTGGTCAACCAGGATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 906 records

Wild obs. + sensor1 613

Museum / vouchered293

Origin

Native20

Range

Area of Occupancy AOO3 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 597≤1 km 313≤10 km 39>10 km 59

1 008 georeferenced · 605 without coordinates

Open the mapobservation + sensor1 613

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 3≤1 km 28≤10 km 79>10 km 4

114 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence293

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	85
Washington, US	32
San Francisco, US	23
Los Angeles, US	20
Essig Museum of Entomologylocation not on record	15
CASlocation not on record	14
Cornell University Insect Collectionlocation not on record	14
Santa Cruz, US	10
UCBMElocation not on record	7
Mexico City, MX	5
University Park, US	4
San Diego, US	3
UCRClocation not on record	2
Montréal, CA	2
Royal British Columbia Museumlocation not on record	2
East Lansing, US	2
New Haven, US	1
California Academy of Scienceslocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1

19 institutions · 243 of 293 vouchered records shown · 50 without an institution code

09Environmental DNA3 detections

Where the DNA of Archilestes californicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 14.8–17.8

Seasonal swing summer↔winter21.3 °C

Max temp (day)24.7 °C 21.2–24.7

Min temp (night)12.4 °C 9.50–12.4

Precipitation12.7 mm/mo 12.7–60.9

Air humidity49.0 % 49.0–57.4

Moisture balance-120 mm/mo -120–-50.8

Vapour deficit1,040 Pa 747–1,040

Wind speed4.70 m/s 3.50–4.70

Cloud cover36.9 % 36.9–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archilestes californicus

At a glance

Sources8 archives

At a glance

Record type1 906 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 906 records