Archiearis infans

(Möschler, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Archiearis

At a glance

Occurrence records1 424

Data sources8

Biological traits0

DNA specimens20

eDNA detections19

Sources8 archives

Databases and archives Archiearis infans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 424 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD20 specimens

01Narrative

Archiearis infans, the infant, is a moth of the family Geometridae. The species was first described by Heinrich Benno Möschler in 1862. It is found from Alaska to Newfoundland and the northern United States, south in the east to New Jersey, south in the west to California. Archiearis infans oregonensis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archiearis infans has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 58 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

14Amostly conserved

15Tmostly conserved

17Tmostly conserved

20Gmostly conserved

22Tmostly conserved

23Amostly conserved

24Tmostly conserved

26Tmostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

47Tmostly conserved

48Cmostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

202Gvariable

562Tmostly conserved

586Tmostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archiearis partheniassame genus2.7%Boudinotiana puellasame family7.8%Xenimpia chalepasame family7.9%Idiochroa demissasame family7.9%Astygisa morosasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 424 records

Wild obs. + sensor991

Museum / vouchered433

Range

Area of Occupancy AOO3 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 516≤1 km 173≤10 km 92>10 km 50

831 georeferenced · 160 without coordinates

Open the mapobservation + sensor991

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 6≤1 km 166≤10 km 166>10 km 26

364 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence433

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	121
East Lansing, US	92
Edmonton, CA	72
KWPlocation not on record	46
University of Alberta Museums (UAM)location not on record	31
Cambridge, US	15
UNHClocation not on record	7
Royal Saskatchewan Museumlocation not on record	6
Vernal, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Toronto, CA	5
Natural History Museum of Utahlocation not on record	4
Decorah, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Cornell University Insect Collectionlocation not on record	2
Denver, US	1
Colorado State Universitylocation not on record	1
Saint John, CA	1

18 institutions · 421 of 433 vouchered records shown · 12 without an institution code

09Environmental DNA19 detections

Where the DNA of Archiearis infans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

Temperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 4.30–18.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)13.4 °C 9.70–23.7

Min temp (night)4.40 °C -0.5–15.2

Precipitation83.9 mm/mo 52.3–105

Air humidity57.4 % 54.8–60.2

Moisture balance-18.4 mm/mo -61.0–21.4

Vapour deficit466 Pa 357–888

Wind speed3.10 m/s 2.20–4.00

Cloud cover42.8 % 39.9–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archiearis infans

At a glance

Sources8 archives

At a glance

Record type1 424 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 424 records