Archidendron vaillantii

(F.Muell.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Archidendron

At a glance

Occurrence records221

Data sources7

Biological traits30

DNA specimens6

eDNA detections3

Sources7 archives

Databases and archives Archidendron vaillantii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility221 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF221 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Archidendron vaillantii là một loài thực vật có hoa trong họ Đậu. Loài này được (F.Muell.) F.Muell. miêu tả khoa học đầu tiên. Archidendron vaillantii được mô tả bởi (F.Muell.) F.Muell. trong ấn bản Fragmenta Phytographiæ Australiæ 5: 69. 1865. Danh pháp đồng nghĩa: - Pithecellobium vaillantii F. Muell. basónimo

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology8

Fruit length75 mm

Fruit width15 mm

Leaf length130 mm

Leaf mass per area39.38 g/m2

Leaf width70 mm

Plant height15 m

⚠ sources differ — GIFT: 15 m · AusTraits: 25 m

Seed length10 mm

Seed width5 mm

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal typeanimal

Flowering timennnnnnnnnnyn

Life formtree

Life spanperennial

Pollination syndromemoth

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density370 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archidendron vaillantii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM286972.1 ↗708 bpAustralia

ACGT

AACCTGCGGAAGGATCATTGTCGTAGCCACACAAAAAGAGCGACCCGCGAACCGGTTGGAACGAACCTCTTGCGGGGGAGGGCGACGGCG …

Archidendron vaillantii voucher MEL 2041191A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type221 records

Wild obs. + sensor6

Museum / vouchered194

Other21

Origin

Native4

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 14≤1 km 55≤10 km 78>10 km 23

170 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	91
Brisbane, AU	33
Museo Entomologico de Leonlocation not on record	25
Canberra, AU	13
James Cook Townsvillelocation not on record	7
Mount Annan, AU	4
Kew, GB	3
Australian Tropical Herbariumlocation not on record	2
Palmerston, AU	2
Bronx, US	1
Parkville, AU	1
University of the Sunshine Coastlocation not on record	1
Honolulu, US	1

13 institutions · 184 of 194 vouchered records shown · 10 without an institution code

09Environmental DNA3 detections

Where the DNA of Archidendron vaillantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 16.6–23.0

Seasonal swing summer↔winter8.30 °C

Max temp (day)26.6 °C 21.1–27.4

Min temp (night)18.2 °C 12.6–19.1

Precipitation135 mm/mo 56.4–158

Air humidity65.4 % 61.2–67.0

Moisture balance-30.1 mm/mo -61.5–-9.30

Vapour deficit870 Pa 726–963

Wind speed2.70 m/s 2.30–3.30

Cloud cover29.2 % 27.0–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)