Archidendron lucyi

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Archidendron

At a glance

Occurrence records308

Data sources9

Biological traits28

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Archidendron lucyi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility308 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF308 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Archidendron lucyi is a small tree species in the legume family (Fabaceae). The native range extends from North Eastern Australia, Eastern Malesia to the Solomon Islands. A. lucyi grows in the understorey of lowland rainforest. As with other members of the genus, A. lucyi produces large pinnate leaves. The species is cauliflorous, producing flowers directly from the trunk. The cream coloured filaments are 3–5 cm long and form the showiest part of the flowers. The flowers are followed by highly conspicuous red or orange seed pods, which split open when ripe to reveal black seeds. Seed pods

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length95 mm

Fruit width20 mm

Leaf length75 mm

Leaf width115 mm

Plant height20 m

Seed length13 mm

⚠ sources differ — TRY: 13 mm · AusTraits: 14.5 mm

Seed mass480 mg

⚠ sources differ — TRY: 480 mg · AusTraits: 450 mg · GIFT: 480 mg

Seed mass max480 mg

Seed mass min480 mg

Seed width10 mm

Life cycle & reproduction5

Dispersal typeanimal

Flowering timeyyyyynnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical obovate ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archidendron lucyi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM286958.1 ↗707 bpAustralia

ACGT

AACCTGCGGAAGGATCATTGTCGATGCCACACAAAAAGAGCGACCCGCGAACCGGTTGGAACGAACCTCTTGCGGGGGAGGGCGACGGCG …

Archidendron lucyi voucher MEL 2391968A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL1★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type308 records

Wild obs. + sensor14

Museum / vouchered244

Cultivated / captive1

Other49

Origin

Native1

Introduced3

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 3≤10 km 3

8 georeferenced · 6 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 5≤1 km 47≤10 km 101>10 km 15

168 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence244

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	73
Canberra, AU	47
Museo Entomologico de Leonlocation not on record	23
Brisbane, AU	22
Kew, GB	17
Honolulu, US	6
Parkville, AU	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Wlocation not on record	2
St. Paul, US	2
Bronx, US	1
James Cook Townsvillelocation not on record	1
Mount Annan, AU	1
Cambridge, US	1
South Kensington, GB	1
Palmerston, AU	1

16 institutions · 205 of 244 vouchered records shown · 38 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Archidendron lucyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C

Min temp (night)20.7 °C

Precipitation341 mm/mo

Air humidity74.2 %

Moisture balance252 mm/mo

Vapour deficit715 Pa

Wind speed2.10 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)