Archidendron hendersonii

(F.Muell.) I.C.Nielsen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Archidendron

At a glance

Occurrence records656

Data sources8

Biological traits36

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Archidendron hendersonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF656 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Archidendron hendersonii, the white lace flower or tulip siris, is a rainforest tree in eastern Australia. A rare plant, listed as vulnerable, it is named after J.A. Henderson, who collected the original specimen at Ballina. It grows north from the Richmond River, New South Wales up to Cape Melville in tropical Queensland. The tree grows up to 18 metres tall with a trunk diameter of 60 cm. Its former habitat of riverine and lowland sub-tropical rainforest in New South Wales is mostly destroyed for housing and agriculture.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length85 mm

Fruit width13.5 mm

Leaf length87.5 mm

Leaf length max130 mm

Leaf length min40 mm

Leaf width40 mm

Leaf width max60 mm

Leaf width min20 mm

Petiole length2.25 cm

Plant height30 m

Plant height max18 m

Seed length11 mm

⚠ sources differ — TRY: 11 mm · AusTraits: 5 mm

Seed width5 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering endDec

Flowering startSep

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density525 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archidendron hendersonii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes5

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM286938.1 ↗708 bpAustralia

ACGT

AACCTGCGGAAGGATCATTGCTGATGCCACACAAAAAGAGCGACCCGCGAACCGGTTGGAACGAACCTCTAGCGGGGGAGGGCGACGGCG …

Archidendron hendersonii voucher QRS 18805.2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★rbcLa★ITS4trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type656 records

Wild obs. + sensor405

Museum / vouchered242

Cultivated / captive2

Other7

Origin

Native27

Introduced1

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 364≤1 km 18≤10 km 4

386 georeferenced · 19 without coordinates

Open the mapobservation + sensor405

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 33≤1 km 37≤10 km 115>10 km 25

210 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence242

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	72
Smithfield, AU	64
Museo Entomologico de Leonlocation not on record	29
Mount Annan, AU	27
Canberra, AU	13
Armidale, AU	10
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Kew, GB	4
Parkville, AU	2
James Cook Townsvillelocation not on record	2
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Honolulu, US	1

13 institutions · 232 of 242 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Archidendron hendersonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 20.4–20.4

Seasonal swing summer↔winter7.90 °C

Max temp (day)22.3 °C

Min temp (night)18.6 °C

Precipitation136 mm/mo

Air humidity59.9 %

Vapour deficit964 Pa

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)