Archidendron grandiflorum

(Benth.) I.C.Nielsen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Archidendron

At a glance

Occurrence records906

Data sources9

Biological traits36

DNA specimens16

eDNA detections7

Sources9 archives

Databases and archives Archidendron grandiflorum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF906 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Archidendron grandiflorum, the pink laceflower, is a species of tree found in northern Australia and New Guinea. This tree reaches a height of 15 meters and bears showy pink and cream colored flowers. The mature tree has a rounded habit and is used as an ornamental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length200 mm

Fruit width25 mm

Leaf length40 mm

Leaf length max100 mm

Leaf length min70 mm

Leaf mass per area77.77 g/m2

Leaf width20 mm

Leaf width max40 mm

Leaf width min20 mm

Petiole length4 cm

Plant height20 m

Plant height max15 m

Seed length14 mm

Seed width8 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscencedehiscent

Flowering endMar

Flowering startSep

Flowering timeyyyyyyynnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density538 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archidendron grandiflorum has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes5

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM286932.1 ↗601 bpAustralia

ACGT

CGACAACCAAACCCCGGCGCCTCAGGCGCCAAGGAACCGAAACAAAGCGAGGCGCGCTCGCTGGCGGCCCGGGAACGGCGCCGATCACCC …

Archidendron grandiflorum voucher CNS 131336.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS4trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type906 records

Wild obs. + sensor409

Museum / vouchered411

Cultivated / captive4

Other82

Origin

Native35

Introduced4

Range

Area of Occupancy AOO2 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 342≤1 km 27≤10 km 9>10 km 7

385 georeferenced · 24 without coordinates

Open the mapobservation + sensor409

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 33≤1 km 52≤10 km 206>10 km 53

344 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence411

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	129
Brisbane, AU	108
Museo Entomologico de Leonlocation not on record	48
Mount Annan, AU	38
Canberra, AU	29
Armidale, AU	9
Kew, GB	6
Palmerston, AU	6
Parkville, AU	5
James Cook Townsvillelocation not on record	4
Australian Tropical Herbariumlocation not on record	4
Honolulu, US	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
University of Stellenboschlocation not on record	1
Adelaide, AU	1

15 institutions · 394 of 411 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Archidendron grandiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 17.5–24.0

Seasonal swing summer↔winter6.80 °C

Max temp (day)25.6 °C 22.4–28.2

Min temp (night)19.8 °C 13.4–20.2

Precipitation132 mm/mo 50.1–407

Air humidity63.2 % 53.9–71.8

Moisture balance16.5 mm/mo -117–214

Vapour deficit823 Pa 736–1,303

Wind speed3.00 m/s 1.80–3.40

Cloud cover36.4 % 21.8–60.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)