Archidendron bigeminum

(L.) I.C.Nielsen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Archidendron

At a glance

Occurrence records125

Data sources9

Biological traits10

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Archidendron bigeminum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.47 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT1.5 Gbp

01Narrative

Archidendron bigeminum is a tree species in the legume family (Fabaceae). It is found in India and Sri Lanka. It is known as "kalitiya - කලටිය" in Sinhala. The World Conservation Monitoring Centre (WCMC) in the 1998 IUCN Redlist reviewed Abarema bigemina and Pithecellobium gracile as Vulnerable species. These are nowadays both considered junior synonyms of Archidendron bigeminum.ILDIS (2005) It may be that the Indian population consists of a smaller-growing variety than that on Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 200 m

Elevation min800 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archidendron bigeminum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR165005.1 ↗482 bpBrazil

ACGT

GTACAGAGAGACCCGCGGACCGGTTGGATAAACTCTCGTCCGGGGGCGCACCGCCCCCGGCAACGAAACCCCGGCGCCTCGGCGCCAGGA …

Archidendron bigeminum voucher E. Barboza et al. 1830 (MBM) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Archidendron bigeminum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 467 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Archidendron bigeminum1.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type125 records

Wild obs. + sensor68

Museum / vouchered57

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 34≤1 km 8≤10 km 4>10 km 18

64 georeferenced · 4 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 9

9 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	23
Xiamen, CN	20
Kew, GB	3
Bronx, US	1
University of Stellenboschlocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1

6 institutions · 49 of 57 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Archidendron bigeminum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)