Archichauliodes diversus

(Walker, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Megaloptera/Corydalidae/Archichauliodes

At a glance

Occurrence records5 625

Data sources8

Biological traits0

DNA specimens157

eDNA detections5

Sources8 archives

Databases and archives Archichauliodes diversus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 625 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics157 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 625 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD157 specimens

01Narrative

Archichauliodes diversus is an insect in the subfamily Chauliodinae - the fishflies, though it is often referred to as the New Zealand dobsonfly, despite not being a true dobsonfly. In its larval form it is commonly known by the name toe-biter, and its Māori name is puene. The species is native to New Zealand. Although there are many other species of fishfly in other parts of the world, Archichauliodes diversus is the only species of fishfly in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding157 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archichauliodes diversus has left across the world's sequence archives.

At a glance

DNA specimens157

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus151 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 82 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

13Cmostly conserved

14Tmostly conserved

15Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

23Gmostly conserved

25Tmostly conserved

26Tmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

33Gmostly conserved

34Gvariable

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Gvariable

50Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Cmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Cmostly conserved

81Amostly conserved

82Amostly conserved

83Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Gvariable

89Tmostly conserved

90Cmostly conserved

106Cmostly conserved

115Tmostly conserved

145Tmostly conserved

172Cmostly conserved

217Amostly conserved

226Tmostly conserved

235Cvariable

244Amostly conserved

280Gmostly conserved

298Tmostly conserved

418Amostly conserved

433Gmostly conserved

520Cmostly conserved

529Amostly conserved

571Tmostly conserved

616Tmostly conserved

628Gvariable

631Gvariable

634Tmostly conserved

AACTTTATATTTCTTATTTGGAGCTTGATCAGGGATAGTAGGAACTTCGTTAAGACTATTAATTCGAGCTGAATTAGGACAACCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes29

BIN1

Most divergent pair12.8%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sinochauliodes squalidussame family12.1%Lebia soleasame order13.7%Coptodera aeratasame order15.5%Morellia micanssame order15.7%Morellia aenescenssame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082909 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type5 625 records

Wild obs. + sensor4 276

Museum / vouchered1 349

Range

Area of Occupancy AOO5 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 466≤1 km 147≤10 km 41>10 km 33

687 georeferenced · 3 589 without coordinates

Open the mapobservation + sensor4 276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 12≤1 km 109≤10 km 74>10 km 1

196 georeferenced · 1 153 without coordinates

Open the institutions mapphysical evidence1 349

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	201
Washington, US	85
MWLRlocation not on record	72
College Station, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
New Haven, US	1
Canterbury Museumlocation not on record	1

7 institutions · 366 of 1 349 vouchered records shown · 983 without an institution code

09Environmental DNA5 detections

Where the DNA of Archichauliodes diversus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 13.5–16.4

Seasonal swing summer↔winter10.2 °C

Max temp (day)19.2 °C 17.7–20.6

Min temp (night)10.6 °C 9.50–11.7

Precipitation182 mm/mo 146–219

Air humidity63.0 % 62.7–63.4

Moisture balance52.1 mm/mo 6.60–97.7

Vapour deficit633 Pa 568–698

Wind speed2.90 m/s 2.30–3.50

Cloud cover38.7 % 37.5–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archichauliodes diversus

At a glance

Sources8 archives

At a glance

Record type5 625 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 625 records