Archaster typicus

Müller & Troschel, 1840 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Valvatida/Archasteridae/Archaster

At a glance

Occurrence records1 576

Data sources10

Biological traits0

DNA specimens12

eDNA detections12

Sources10 archives

Databases and archives Archaster typicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 215 records↗

OBISOcean Biodiversity Information System361 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS52 compounds

Occurrence & distributionGBIF · OBIS1 576 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Archaster typicus is een zeester uit de familie Archasteridae. De wetenschappelijke naam van de soort werd in 1840 gepubliceerd door Johannes Peter Müller & Franz Hermann Troschel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition52 compounds

Compounds documented for Archaster typicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids9

Acyclic monoterpenoids7

Furofuranoid lignans7

N-acyl amines6

Quinoline alkaloids3

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Piperitol	present	NPASS
(2R,3R,4S,5S,6R)-2-((Z)-hex-3-enoxy)-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(1S,4S,5R)-4-hydroxy-4-[(E,3R)-3-hydroxybut-1-enyl]-3,3,5-trimethylcyclohexyl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(3S)-3,7-dimethyloct-6-enoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-[[(2R,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-(2-methylpropoxy)oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6S)-2-[[(2R,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[(3S)-3,7-dimethylocta-1,6-dien-3-yl]oxyoxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[(3S,6S)-6-ethenyl-2,2,6-trimethyloxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[2-[(2R,5S)-5-ethenyl-5-methyloxolan-2-yl]propan-2-yloxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(3S,4R,5S,6S,8S,9R,10S,13R,14R,15S,17R)-17-[(2R,5R)-5-hydroxyheptan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3,4,6,8,14,15-hexol	present	LOTUS
(3S,4S,5R,6S,8S,9R,10R,13R,14R,15S,17R)-17-[(2R,5R)-5-hydroxyheptan-2-yl]-10,13-dimethyl-1,2,3,4,6,7,9,11,12,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3,4,5,6,8,14,15-heptol	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archaster typicus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

23Gmostly conserved

223Avariable

232Gvariable

304Amostly conserved

352Amostly conserved

425Amostly conserved

454Tvariable

521Gmostly conserved

523Amostly conserved

554Gmostly conserved

565Gvariable

568Amostly conserved

625Tvariable

658Tvariable

AACCCTATATCTAATCTTTGGAGCTTGGGCAGGAATGGTAGGAACTGCCATGAGTGTAATAATACGCACAGAACTTGCCCAGCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes3

BIN1

Most divergent pair1.2%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinaster callosussame order14.9%Anthenea asperasame order15.3%Pentaceraster cumingisame order16.0%Valvaster striatussame order16.9%Gomophia egyptiacasame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 576 records

Wild obs. + sensor994

Museum / vouchered580

Other2

Range

Area of Occupancy AOO2 320 km²

Depth

0–200 m sunlit49

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 67.7 m · 49 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 391≤1 km 237≤10 km 102>10 km 38

768 georeferenced · 226 without coordinates

Open the mapobservation + sensor994

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 8≤1 km 73≤10 km 98>10 km 38

217 georeferenced · 363 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	88
Washington, US	52
CASlocation not on record	44
Cambridge, US	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	18
Western Australian Museumlocation not on record	16
Earth Sciences New Zealandlocation not on record	9
Natick, US	6
Museum and Art Gallery of the Northern Territorylocation not on record	5
RBINS-Scientific Heritagelocation not on record	5
Brussels, BE	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
Tasmanian Museum & Art Gallerylocation not on record	2
Los Angeles, US	2
Frankfurt am Main	2
Honolulu, US	2
Stockholm, SE	1
Paris, FR	1
Toronto, CA	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

21 institutions · 287 of 580 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Archaster typicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.3–26.9

Seasonal swing summer↔winter3.80 °C

Max temp (day)25.7 °C 25.7–27.8

Min temp (night)24.8 °C 24.8–25.8

Precipitation89.7 mm/mo 89.7–151

Air humidity61.1 % 61.1–63.0

Vapour deficit1,245 Pa 1,245–1,312

Cloud cover48.4 % 48.4–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archaster typicus

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds52 total

At a glance

Record type1 576 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 576 records