Archasia belfragei

Stål · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Membracidae/Archasia

At a glance

Occurrence records515

Data sources5

Biological traits0

DNA specimens4

eDNA detections4

Sources5 archives

Databases and archives Archasia belfragei's data was compiled from.

GBIFGlobal Biodiversity Information Facility515 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF515 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archasia belfragei has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

28Avariable

61Cmostly conserved

94Cvariable

187Tmostly conserved

202Avariable

343Amostly conserved

349Avariable

388Cvariable

389Gmostly conserved

400Cvariable

418Tmostly conserved

430Avariable

454Avariable

574Cmostly conserved

619Avariable

AACCTTATACTTTATTTTCGGAATATGATCAGGAATAATCGGGATAATATTAAGAATAATCATTCGAATTGAATTAGGTCAACCAGGTCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Telamona monticolasame family5.9%Carynota stupidasame family6.4%Telamona reclivatasame family6.4%Telamona tristissame family6.7%Glossonotus univittatussame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type515 records

Wild obs. + sensor395

Museum / vouchered120

Range

Area of Occupancy AOO1 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 229≤1 km 63≤10 km 9>10 km 49

350 georeferenced · 45 without coordinates

Open the mapobservation + sensor395

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 7≤10 km 13>10 km 1

21 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	59
Champaign, US	27
OSUClocation not on record	13
University of Central Floridalocation not on record	11
Mississippi State, US	3
Espace pour la vielocation not on record	2
Lubbock, US	1
University of Guelphlocation not on record	1
CUlocation not on record	1
Provo, US	1
University Park, US	1

11 institutions · 120 of 120 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Archasia belfragei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 15.1–18.7

Seasonal swing summer↔winter34.2 °C

Max temp (day)21.2 °C 21.2–24.2

Min temp (night)9.60 °C 9.60–13.7

Precipitation78.7 mm/mo 78.7–114

Air humidity55.9 % 55.8–55.9

Moisture balance-42.4 mm/mo -42.4–-41.6

Vapour deficit758 Pa 758–960

Wind speed2.50 m/s 2.50–4.00

Cloud cover47.8 % 43.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)