Archamia bleekeri

(Günther, 1859) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Archamia

At a glance

Occurrence records141

Data sources9

Biological traits7

DNA specimens32

eDNA detections29

Sources9 archives

Databases and archives Archamia bleekeri's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

OBISOcean Biodiversity Information System61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS141 records

Environmental DNA1 datasets · 4 countries29 detections

DNA & barcodingBOLD32 specimens

01Narrative

Archamia bleekeri, also known as Gon's cardinalfish, is a species of fish in the family Apogonidae, the cardinalfishes. It is native to the coastal waters of the Indian Ocean and the western Pacific Ocean from Africa to Indonesia and from Taiwan to Queensland, Australia. This species occurs in mangrove forests and reefs, and is an inhabitant of shipwrecks, preferring silty areas with muddy or sandy substrates. This species grows to a total length of 10 cm. This species is the only member of its genus. The other species were moved to the new genus Taeniamia in 2013.Fraser, T.H. (2013): A new genus of cardinalfish (Apogonidae: Percomorpha), redescription of Archamia and resemblances and relationships with Kurtus (Kurtidae: Percomorpha). Zootaxa, 3714 (1): 1–63.Mabuchi, K., Fraser, T.H., Song, H., Azuma, Y. & Nishida, M. (2014): Revision of the systematics of the cardinalfishes (Percomorpha: Apogonidae) based on molecular analyses and comparative reevaluation of morphological characters. Zootaxa, 3846 (2): 151–203.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length12.6 cm

Body mass23.2 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max30 m

Depth min10 m

Vulnerability10

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archamia bleekeri has left across the world's sequence archives.

At a glance

DNA specimens32

BINs4

Marker genes2

eDNA detections29

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

31Amostly conserved

124Tmostly conserved

136Cmostly conserved

175Tmostly conserved

178Amostly conserved

214Cmostly conserved

271Tmostly conserved

283Amostly conserved

284Cmostly conserved

286Amostly conserved

292Cmostly conserved

298Tvariable

301Tmostly conserved

319Amostly conserved

346Avariable

352Tmostly conserved

379Amostly conserved

394Cmostly conserved

400Cmostly conserved

445Cmostly conserved

475Gvariable

484Amostly conserved

493Cmostly conserved

496Amostly conserved

497Cvariable

505Cmostly conserved

556Amostly conserved

580Cvariable

583Gmostly conserved

592Tmostly conserved

619Gmostly conserved

628Gmostly conserved

CCTTTATATAGTATTTGGTGCCTGAGCCGGAATAGTAGGGACCGCCCTTAGCTTGCTCATCCGGGCCGAGCTGAGCCAACCCGGGGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs4

Most divergent pair4.1%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Taeniamia zosterophorasame family13.0%Ostorhinchus capricornissame family14.1%Cheilodipterus intermediussame family14.3%Pristicon rhodopterussame family14.3%Jaydia smithisame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type141 records

Wild obs. + sensor51

Museum / vouchered76

Other14

Range

Area of Occupancy AOO300 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9 m · max 33 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 6≤1 km 12≤10 km 4>10 km 4

26 georeferenced · 25 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 2≤1 km 5≤10 km 5>10 km 3

15 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	6
South African Institute for Aquatic Biodiversitylocation not on record	5
Australian National Fish Collectionlocation not on record	4
Chicago, US	3
CASlocation not on record	2
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Academia Sinica, Biodiversity Research Centerlocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
FishBaselocation not on record	1
Frankfurt am Main	1
Western Australian Museumlocation not on record	1
Sydney, AU	1
CSIRO, Australian National Fish Collectionlocation not on record	1

13 institutions · 28 of 76 vouchered records shown · 14 without an institution code

09Environmental DNA29 detections

Where the DNA of Archamia bleekeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 23.5–26.8

Seasonal swing summer↔winter2.70 °C

Max temp (day)27.6 °C 25.4–28.2

Min temp (night)24.2 °C 20.8–25.6

Precipitation171 mm/mo 53.5–296

Air humidity65.8 % 63.3–68.1

Vapour deficit1,148 Pa 1,064–1,161

Cloud cover48.2 % 42.0–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)