Archaeoattacus edwardsii

White, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Archaeoattacus

At a glance

Occurrence records58

Data sources8

Biological traits0

DNA specimens10

eDNA detections60

Sources8 archives

Databases and archives Archaeoattacus edwardsii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 9 countries60 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 64

01Narrative

Archaeoattacus edwardsii, or Edward's Atlas moth, is a moth belonging to the family Saturniidae and subfamily Saturniinae. The species was first described by Francis Buchanan White in 1859.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archaeoattacus edwardsii has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections60

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BINs2

Most divergent pair0.30%

Where individuals differ — all 27 variable positions, in barcode order

13Cmostly conserved

25Tmostly conserved

79Amostly conserved

217Gmostly conserved

250Tmostly conserved

253Amostly conserved

266Cmostly conserved

287Tmostly conserved

316Amostly conserved

334Cmostly conserved

361Cmostly conserved

364Tmostly conserved

433Gmostly conserved

466Gmostly conserved

484Amostly conserved

508Amostly conserved

541Amostly conserved

542Tmostly conserved

547Cmostly conserved

565Gvariable

583Tmostly conserved

595Tvariable

616Cmostly conserved

619Amostly conserved

637Tmostly conserved

651Amostly conserved

652Tmostly conserved

AACTTTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGCACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archaeoattacus vietnamensissame genus2.3%Archaeoattacus staudingerisame genus3.2%Samia formosanasame family8.2%Neodiphthera venustasame family8.8%Hyalophora euryalussame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Archaeoattacus edwardsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type58 records

Wild obs. + sensor48

Museum / vouchered10

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 17≤1 km 13≤10 km 8>10 km 5

43 georeferenced · 5 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 5>10 km 1

7 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	4
Natural History Museum of Utahlocation not on record	2
Auckland, NZ	1

3 institutions · 7 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA60 detections

Where the DNA of Archaeoattacus edwardsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 16.4–27.0

Seasonal swing summer↔winter9.40 °C

Max temp (day)27.1 °C 19.5–30.5

Min temp (night)19.2 °C 11.6–23.4

Precipitation316 mm/mo 144–579

Air humidity69.7 % 64.1–74.5

Moisture balance205 mm/mo -2.00–457

Vapour deficit901 Pa 543–1,170

Wind speed1.00 m/s 0.6–2.30

Cloud cover48.7 % 31.3–69.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)