Archachatina marginata

(Swainson, 1821) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Achatinidae/Archachatina

At a glance

Occurrence records239

Data sources8

Biological traits0

DNA specimens29

eDNA detections28

Sources8 archives

Databases and archives Archachatina marginata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD29 specimens

01Narrative

The giant West African snail or banana rasp snail (Archachatina marginata) is a species of air-breathing tropical land snail, a terrestrial pulmonate gastropod mollusk in the family Achatinidae. They can grow up to 20 cm long, and live up to 10 years or more.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archachatina marginata has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections28

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TTTTGGGGTTTGATGTGGTCTAGTCGGGACTGGTCTCTCATTGTTGATTCGATTAGAATTAGGTACGGCCGGAGTATTAACAGACGATCA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor98

Museum / vouchered140

Other1

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 29≤1 km 15≤10 km 17>10 km 14

75 georeferenced · 23 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 8≤1 km 21≤10 km 12>10 km 16

57 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	38
Royal Museum for Central Africalocation not on record	34
Philadelphia, US	11
Chongqing Museumlocation not on record	10
Barcelona, ES	6
Ann Arbor, US	4
Denver, US	3
Salzburg, AT	2
Natural History Museum Rotterdamlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Chicago, US	1
Brussels, BE	1
Saint John, CA	1

13 institutions · 113 of 140 vouchered records shown · 27 without an institution code

09Environmental DNA28 detections

Where the DNA of Archachatina marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.8–27.7

Seasonal swing summer↔winter3.90 °C

Max temp (day)33.9 °C 33.4–34.7

Min temp (night)22.0 °C 20.7–22.5

Precipitation7.80 mm/mo 1.60–9.70

Air humidity55.5 % 40.1–58.1

Moisture balance-141 mm/mo -147–-124

Vapour deficit1,559 Pa 1,465–2,128

Wind speed2.00 m/s 1.50–2.50

Cloud cover11.8 % 11.8–12.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)