Arceuthobium gillii

Hawksw. & Wiens · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Viscaceae/Arceuthobium

At a glance

Occurrence records96

Data sources11

Biological traits9

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Arceuthobium gillii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Arceuthobium gillii, common name "Chihuahua pine dwarf mistletoe," is a parasitic plant found in Arizona, New Mexico, Chihuahua, Sonora and Sinaloa. It is found mostly on the Chihuahua pine, Pinus leiophylla var. chihuahuana.Hawksworth, F.G., & D. Wiens. 1993. Viscaceae, Mistletoe Family. Journal of the Arizona-Nevada Academy of Science 27:241-245 The species was named in honor of Lake Shore Gill, an authority on the genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formhemiparasitic epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arceuthobium gillii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN721921.2 ↗2 843 bpMexico · 1989

ACGT

TGTGTATGAGATGTATCTCTTTAACTATAGTATATGATTTTTTCTTGGGGAAGCGAATAATATGTTATTATATACTATTATTTTAGGTGG …

Arceuthobium gillii external transcribed spacer, partial sequence; small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arceuthobium gillii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 142×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — WIENS, D. 1968. Chromosomal and flowering characteristics in dwarf mistletoes (Arceuthoblum). Amer J. Bot. 55: 325-334.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type96 records

Wild obs. + sensor1

Museum / vouchered95

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 39≤1 km 1≤10 km 14>10 km 2

56 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	28
Flagstaff, US	16
Austin, US	8
Chapingo, MX	6
Mexico City, MX	4
Guasave, MX	4
University of Stellenboschlocation not on record	4
US	3
ASUlocation not on record	3
Montecillo, Texcoco, MX	2
Albuquerque, US	1
Tapachula, MX	1
Mexico City, MX	1
Chicago, US	1
Logan, US	1
Claremont, US	1
USDA Forest Service (FS)location not on record	1
Juriquilla, MX	1

18 institutions · 86 of 95 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Arceuthobium gillii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)