Arceuthobium campylopodum

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Viscaceae/Arceuthobium

At a glance

Occurrence records819

Data sources9

Biological traits9

DNA specimens6

eDNA detections5

Sources9 archives

Databases and archives Arceuthobium campylopodum's data was compiled from.

GBIFGlobal Biodiversity Information Facility819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF819 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 28

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formhemiparasitic epiphyte

Life spanperennial

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arceuthobium campylopodum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235083.1 ↗358 bpCanada · 1985

ACGT

TGCAGAATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAGTTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT …

Arceuthobium campylopodum voucher CCDB-24905-C02 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arceuthobium campylopodum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-fedorov

CCDB · book-fedorov — Wiens 1964a

n 142×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — WIENS, D. 1968. Chromosomal and flowering characteristics in dwarf mistletoes (Arceuthoblum). Amer J. Bot. 55: 325-334.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type819 records

Wild obs. + sensor802

Museum / vouchered17

Range

Area of Occupancy AOO1 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 437≤1 km 80≤10 km 38>10 km 26

581 georeferenced · 221 without coordinates

Open the mapobservation + sensor802

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 1≤10 km 3>10 km 1

6 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	2
Moscow State Universitylocation not on record	2
University of British Columbia, Herbariumlocation not on record	2
Jurica-Suchy Nature Museumlocation not on record	1
EL PASO, US	1
Wuzhou, CN	1
Emporia, US	1
Tempe, US	1
Austin, US	1
Catholic University of Pekinglocation not on record	1

10 institutions · 13 of 17 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Arceuthobium campylopodum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Pine Forest with Pinus lambertiana, Calocedr…on Pinus contorta in rocky soil near oceanmontane Tsuga-gaultheria forests com. type, …Parasitic on Tsuga heterophylla

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 14.4–19.4

Seasonal swing summer↔winter13.7 °C

Max temp (day)18.9 °C 17.3–26.3

Min temp (night)13.5 °C 11.5–13.6

Precipitation57.5 mm/mo 14.5–72.2

Air humidity61.5 % 55.2–62.1

Moisture balance-55.2 mm/mo -134–-22.2

Vapour deficit654 Pa 625–1,030

Wind speed1.80 m/s 1.70–2.30

Cloud cover37.2 % 20.3–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)