Arcas imperialis

(Cramer, 1779) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arcas

At a glance

Occurrence records210

Data sources6

Biological traits0

DNA specimens12

eDNA detections1

Sources6 archives

Databases and archives Arcas imperialis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF210 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Arcas imperialis est une espèce d'insectes lépidoptères - ou papillons de la famille des Lycaenidae, sous-famille des Theclinae et du genre Arcas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcas imperialis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.28%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 8 variable positions, in barcode order

22Tmostly conserved

230Amostly conserved

371Cmostly conserved

386Amostly conserved

404Tmostly conserved

539Gmostly conserved

540Tmostly conserved

560Cmostly conserved

CTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGAATCTTAATTCGAATAGAATTAGGAACCCCTGGATCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Superflua sassanidessame family4.7%Podanotum pulsarsame family4.9%Theritas pauperasame family4.9%Oenomaus curiosasame family4.9%Podanotum vanewrightisame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type210 records

Wild obs. + sensor152

Museum / vouchered53

Other5

Origin

Native1

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 54≤1 km 39≤10 km 19>10 km 9

121 georeferenced · 31 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 4≤1 km 4≤10 km 5>10 km 4

17 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Jagiellońskilocation not on record	13
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	7
Cambridge, US	6
Mexico City, MX	6
National Biodiversity Institute, Costa Ricalocation not on record	6
Universidad de los Llanos (UniLlanos)location not on record	3
Ciudad de México, MX	2
Brussels, BE	2
Ciudad de México, MX	1
New Haven, US	1
Zürich, CH	1
RBINS-Scientific Heritagelocation not on record	1
University of Memphislocation not on record	1
Washington, US	1
Universidad Nacional de Colombia (UNAL)location not on record	1

15 institutions · 52 of 53 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Arcas imperialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)