Araucaria nemorosa

de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Araucariaceae/Araucaria

At a glance

Occurrence records54

Data sources10

Biological traits16

DNA specimens7

eDNA detections7

Sources10 archives

Databases and archives Araucaria nemorosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT15.5 Gbp

01Narrative

Araucaria nemorosa est une espèce d'arbres de la famille des Araucariaceae. C'est une des treize espèces endémiques du genre Araucaria de Nouvelle-Calédonie. Cette espèce est inféodée aux terrains ultramafiques.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass520 mg

Seed mass max520 mg

Seed mass min520 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTrain forest

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araucaria nemorosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM459971.1 ↗472 bpNew Caledonia

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTCGGCCGAGGGCACGTCTGCCTGGGCGTCGCACTCCAA …

Araucaria nemorosa 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Araucaria nemorosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size15 501 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Araucaria nemorosa15.5 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Dainty, A. L. 1982. Chromosome numbers and karyotype variation in Araucaria. Kew Bull. 37: 511–514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type54 records

Wild obs. + sensor10

Museum / vouchered44

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 9

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	18
Edinburgh, GB	9
Kew, GB	4
Auckland, NZ	3
Christchurch, NZ	2
GAlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Saint Louis, US	1
Rotorua, NZ	1

9 institutions · 42 of 44 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Araucaria nemorosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)