Araucaria cunninghamii

Aiton ex A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Araucariaceae/Araucaria

At a glance

Occurrence records1 461

Data sources13

Biological traits40

DNA specimens20

eDNA detections19

Sources13 archives

Databases and archives Araucaria cunninghamii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 461 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS42 compounds

Occurrence & distributionGBIF1 461 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB · GoaT14.1 Gbp

01Narrative

Araucaria cunninghamii est un arbre conifère de la famille des Araucariaceae. On le trouve en Australie et en Asie tropicale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length75 mm

Fruit width60 mm

Leaf length3 mm

Leaf length max10 mm

Leaf length min5 mm

Leaf mass per area222 g/m2

Leaf size11.27 mm²

⚠ sources differ — TRY: 11.27 mm² · AusTraits: 10.58 mm²

Leaf width2.5 mm

Plant height50 m

⚠ sources differ — GIFT: 50 m · AusTraits: 50 m · TRY: 70 m

Plant height max50 m

Seed length10 mm

Seed mass227 mg

⚠ sources differ — TRY: 227 mg · AusTraits: 300 mg · GIFT: 283 mg

Seed mass max388 mg

Seed mass min150 mg

Seed width4.5 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnnnyy

Life formtree

Life spanperennial

Lifespan years400 years

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typestrobilus

Growth formtree

Leaf compoundnesssimple

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.69 mm²/mg

Wood density451 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition42 compounds

Compounds documented for Araucaria cunninghamii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids6

Flavones6

Labdane diterpenoids $ Norlabdane diterpenoids5

Cinnamic acids and derivatives3

Humulane sesquiterpenoids3

Documented compounds42 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(1R,4R,7S)-1,7-dimethyl-7-(4-methylpent-3-enyl)bicyclo[2.2.1]heptan-2-one	present	LOTUS
(1S,4aS,8aR)-5-[(E)-5-hydroxy-3-methylpent-3-enyl]-1,4a,6-trimethyl-2,3,4,7,8,8a-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(3R,4S,5R)-Butyl 3,4,5-Trihydroxycyclohex-1-enecarboxylate	present	LOTUS
(4R)-3,5,5-trimethyl-4-[(3S)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybut-1-enyl]cyclohex-2-en-1-one	present	LOTUS
(E)-5-[(4aR,5S,8aS)-5-(hydroxymethyl)-2,5,8a-trimethyl-3,4,4a,6,7,8-hexahydronaphthalen-1-yl]-3-methylpent-2-en-1-ol	present	LOTUS
(R)-Limonene	present	LOTUS
1-(4-Butoxyphenyl)propane-1,2,3-triol	present	LOTUS
15-Acetoxyisocupressic Acid	present	LOTUS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araucaria cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes6

GenBank sequences9

eDNA detections19

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLGQ463543.1 ↗690 bp

ACGT

GGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGCAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGA …

Araucaria cunninghamii voucher PS0988MT01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL7★rbcLa★ITS2trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Araucaria cunninghamii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size14 058 750 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Araucaria cunninghamii14.06 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome records26–262n range26median26mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 264×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Ohri, D. & T. N. Khoshoo. 1986. Genome size in gymnosperms. Pl. Syst. Evol. 153: 119–132.

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 461 records

Wild obs. + sensor1 421

Museum / vouchered33

Cultivated / captive1

Other6

Origin

Introduced32

Range

Area of Occupancy AOO3 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 757≤1 km 153≤10 km 68>10 km 110

1 088 georeferenced · 333 without coordinates

Open the mapobservation + sensor1 421

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence33

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	5
Siouxland Heritage Museumlocation not on record	4
Beijing, CN	3
Guilin, CN	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
EL PASO, US	2
TAFORI-LSRClocation not on record	2
LDlocation not on record	2
Guangzhou, CN	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Nanjing, CN	1
Sanda, JP	1
Uppsala, SE	1

15 institutions · 31 of 33 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA19 detections

Where the DNA of Araucaria cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 16.7–20.6

Seasonal swing summer↔winter8.90 °C

Max temp (day)22.3 °C 19.2–23.4

Min temp (night)18.0 °C 13.1–18.4

Precipitation139 mm/mo 137–330

Air humidity59.9 % 59.0–68.3

Moisture balance284 mm/mo

Vapour deficit964 Pa 616–1,000

Wind speed3.70 m/s

Cloud cover25.8 % 25.3–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araucaria cunninghamii

At a glance

Sources13 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds42 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 461 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 461 records