Araneus thaddeus

(Hentz, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records813

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Araneus thaddeus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF813 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Araneus thaddeus or the lattice orbweaver, is a species of orb weaver in the spider family Araneidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus thaddeus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

1Avariable

109Amostly conserved

110Tmostly conserved

220Avariable

304Avariable

364Amostly conserved

478Tmostly conserved

493Gmostly conserved

502Amostly conserved

533Cmostly conserved

544Cmostly conserved

625Avariable

AACATTATATTTGGTTTTTGGAGCATGGTCAGCTATAGTAGGAACTGCTATAAGAGTTTTGATTCGAATTGAATTAGGTCAGTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes5

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family9.0%Araneus partitussame genus9.3%Eriophora fuligineasame family9.5%Theridion zantholabiosame order10.6%Neoscona blondelisame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type813 records

Wild obs. + sensor749

Museum / vouchered60

Other4

Origin

Native16

Range

Area of Occupancy AOO2 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 362≤1 km 112≤10 km 57>10 km 105

636 georeferenced · 113 without coordinates

Open the mapobservation + sensor749

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 3≤10 km 6

9 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	19
Tapachula, MX	11
Ciudad de México, MX	6
Mexico City, MX	5
Cambridge, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Denver, US	3
Chicago, US	2
Centre for Biodiversity Genomicslocation not on record	1
München, DE	1

10 institutions · 56 of 60 vouchered records shown · 4 without an institution code

09Environmental DNA7 detections

Where the DNA of Araneus thaddeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

beating on the bushesGrasslandBeachgrass sweep

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 6.20–20.5

Seasonal swing summer↔winter26.4 °C

Max temp (day)15.5 °C 10.7–25.4

Min temp (night)7.60 °C 3.30–16.7

Precipitation78.7 mm/mo 73.5–81.6

Air humidity59.5 % 57.7–61.3

Moisture balance12.2 mm/mo -56.7–27.0

Vapour deficit544 Pa 377–981

Wind speed3.70 m/s 3.00–4.50

Cloud cover51.1 % 38.3–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)