Araneus pegnia

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records1 968

Data sources9

Biological traits1

DNA specimens23

eDNA detections23

Sources9 archives

Databases and archives Araneus pegnia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 968 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 968 records

Environmental DNA1 datasets · 4 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Butterfly Orbweaver (Araneus pegnia) male Araneus pegnia is a species of orb weaver in the spider family Araneidae. It is found in a range from the United States to Ecuador and Jamaica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGenaro & Alayón 1994

Defence1

PredatorTrypoxylon subimpressum

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus pegnia has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

1Gmostly conserved

4Gvariable

46Tvariable

61Gmostly conserved

76Amostly conserved

100Amostly conserved

160Amostly conserved

181Amostly conserved

197Tvariable

212Cmostly conserved

244Gvariable

250Tvariable

256Amostly conserved

271Tmostly conserved

274Cvariable

340Tmostly conserved

343Tvariable

403Gmostly conserved

469Amostly conserved

478Amostly conserved

485Tmostly conserved

493Avariable

562Amostly conserved

577Gmostly conserved

581Cvariable

GACGTTATATTTAATTTTTGGGGCTTGATCAGCTATAGTGGGAACTGCAATAAGAGTTTTGATTCGAATTGAGTTAGGTCAGCCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes10

BIN1

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona pratensissame family11.1%Argiope trifasciatasame family11.2%Gibbaranea gibbosasame family11.6%Neoscona cruciferasame family11.9%Metepeira datonasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 968 records

Wild obs. + sensor1 776

Museum / vouchered123

Other69

Origin

Native1

Range

Area of Occupancy AOO5 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 865≤1 km 183≤10 km 87>10 km 337

1 472 georeferenced · 304 without coordinates

Open the mapobservation + sensor1 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 56≤1 km 3≤10 km 4>10 km 4

67 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	56
Tapachula, MX	17
Ciudad de México, MX	16
Ohio State University Acarology Laboratorylocation not on record	8
Buenos Aires, AR	8
Denver, US	6
San Diego, US	5
Cambridge, US	1
Albuquerque, US	1
University of Indianapolislocation not on record	1
San Francisco, US	1
Los Angeles, US	1
Chicago, US	1
US	1

14 institutions · 123 of 123 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Araneus pegnia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

1. Forest & Woodland | 1.5. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 17.2–28.2

Seasonal swing summer↔winter12.1 °C

Max temp (day)28.6 °C 23.7–32.6

Min temp (night)21.2 °C 11.4–24.7

Precipitation64.7 mm/mo 9.40–234

Air humidity61.1 % 46.8–65.8

Moisture balance-57.0 mm/mo

Vapour deficit1,135 Pa 953–1,476

Wind speed2.80 m/s

Cloud cover22.8 % 14.8–32.7

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus pegnia

At a glance

Sources9 archives

Defence1

At a glance

Record type1 968 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 968 records