Araneus nordmanni

(Thorell, 1870) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records3 127

Data sources9

Biological traits9

DNA specimens264

eDNA detections309

Sources9 archives

Databases and archives Araneus nordmanni's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI309 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics264 specimens↗

World Spider Trait DBMasaryk University9 traits · 17 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements17 literature sources9 traits

Occurrence & distributionGBIF3 127 records

Environmental DNA3 datasets · 5 countries309 detections

DNA & barcodingBOLD264 specimens

01Narrative

Araneus nordmanni is a species of orb weaver in the spider family Araneidae. It is found in North America, Europe, Caucasus, a range from Russia to Kazakhstan, Korea, and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 17 sources

Pekár 2014aNature and Landscape Protection Act 2002Buchar & Růžička 2002Hyvärinen et al. 2019Henriksen & Hilmo 2015Gajdoš et al. 2014SLU 2020Gajdoš & Svatoň 2001Komposch & Steinberger 1999Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Finch 2004Noflatscher 1994Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀9.5·♂7.5 mm

Predation1

Hunting guildorb web weavers

Ecology6

Circadian activitynocturnal

Legal protectionYes

Light 2partly shaded

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryExtremely Rare (R)

Defence1

Primary defenceCrypsis

05DNA & barcoding264 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus nordmanni has left across the world's sequence archives.

At a glance

DNA specimens264

BINs1

Marker genes1

eDNA detections309

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus225 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

1Amostly conserved

22Gvariable

40Gmostly conserved

76Amostly conserved

100Gmostly conserved

133Gmostly conserved

145Amostly conserved

205Cmostly conserved

206Tmostly conserved

232Gmostly conserved

334Cmostly conserved

343Tmostly conserved

364Gmostly conserved

478Amostly conserved

484Cmostly conserved

514Gmostly conserved

532Amostly conserved

578Tmostly conserved

AACTTTATATTTAATTTTTGGGGCATGAGCAGCTATAGTGGGAACAGCAATGAGTGTATTGATTCGAATTGAATTAGGTCAACCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes32

BIN1

Most divergent pair3.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus affinissame genus9.7%Araneus gemmoidessame genus10.1%Araneus diadematussame genus11.5%Neoscona subfuscasame family11.6%Gibbaranea gibbosasame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 127 records

Wild obs. + sensor2 569

Museum / vouchered558

Origin

Native4

Range

Area of Occupancy AOO9 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 330≤1 km 420≤10 km 175>10 km 159

2 084 georeferenced · 485 without coordinates

Open the mapobservation + sensor2 569

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 34≤1 km 28≤10 km 22>10 km 28

112 georeferenced · 446 without coordinates

Open the institutions mapphysical evidence558

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	137
Denver, US	36
Cambridge, US	31
Helsinki, FI	29
Edmonton, CA	23
Ekaterinburg, RU	17
Ohio State University Acarology Laboratorylocation not on record	10
SLU Artdatabankenlocation not on record	9
Centre for Biodiversity Genomicslocation not on record	7
neflocation not on record	6
NTNU-VMlocation not on record	5
Albuquerque, US	4
Saint John, CA	4
NSMKlocation not on record	3
University of Alaska Museumlocation not on record	2
Los Angeles, US	2
University of Alberta Museums (UAM)location not on record	2
Rovaniemi, FI	2
Champaign, US	2
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Metsähallituslocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Tartu, EE	1
Chicago, US	1
MZLUlocation not on record	1
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	1
Chicago, US	1
Frankfurt am Main	1

29 institutions · 342 of 558 vouchered records shown · 216 without an institution code

09Environmental DNA309 detections

Where the DNA of Araneus nordmanni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found309

Studies independent surveys3

Countries5

Verifiable raw sequence linked48

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 309 detections have coordinates

Open the map5 countries0

Mixed HabitatWetlandMixed habitaton railing at cottageGrasslandCut

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 7.50–18.4

Seasonal swing summer↔winter23.9 °C

Max temp (day)18.1 °C 11.2–23.2

Min temp (night)8.50 °C 4.00–15.2

Precipitation97.1 mm/mo 58.2–138

Air humidity59.8 % 51.7–64.2

Moisture balance-10.9 mm/mo

Vapour deficit618 Pa 400–900

Wind speed2.70 m/s

Cloud cover42.1 % 31.8–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 308 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus nordmanni

At a glance

Sources9 archives

Morphometry1

Predation1

Ecology6

Defence1

At a glance

Record type3 127 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 127 records