Araneus guttulatus

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records198

Data sources8

Biological traits0

DNA specimens8

eDNA detections10

Sources8 archives

Databases and archives Araneus guttulatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF198 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD8 specimens

01Narrative

Araneus guttulatus is a species of orb weaver in the spider family Araneidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus guttulatus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

5Cmostly conserved

118Cmostly conserved

133Cvariable

136Tmostly conserved

160Gmostly conserved

190Avariable

205Gmostly conserved

206Tmostly conserved

211Gmostly conserved

212Cmostly conserved

265Amostly conserved

271Cmostly conserved

319Tvariable

323Gmostly conserved

376Amostly conserved

379Gmostly conserved

436Tmostly conserved

451Amostly conserved

478Amostly conserved

533Cmostly conserved

548Tvariable

565Gmostly conserved

592Gmostly conserved

616Tvariable

619Tvariable

TACTCTATATTTAGTATTTGGAGCTTGGGCAGCTATAGTTGGCACTGCTATAAGAGTTTTGATTCGAATTGAGTTAGGGCAATCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus partitussame genus12.2%Neoscona blondelisame family12.2%Argiope trifasciatasame family13.0%Eustala californiensissame family13.1%Araneus montereyensissame genus13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type198 records

Wild obs. + sensor185

Museum / vouchered13

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 91≤1 km 33≤10 km 9>10 km 21

154 georeferenced · 31 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Denver, US	1

3 institutions · 10 of 13 vouchered records shown · 3 without an institution code

09Environmental DNA10 detections

Where the DNA of Araneus guttulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Mixed deciduous hardwoods1. Forest & Woodland|1.4. Temperate ForestGrasslandDecid. shrubs at roadsideMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 11.0–24.4

Seasonal swing summer↔winter23.9 °C

Max temp (day)25.7 °C 14.1–29.3

Min temp (night)15.3 °C 8.80–20.1

Precipitation91.4 mm/mo 78.5–123

Air humidity59.2 % 57.4–63.1

Moisture balance-29.4 mm/mo -82.4–34.1

Vapour deficit982 Pa 484–1,269

Wind speed2.50 m/s 2.20–4.20

Cloud cover39.4 % 27.7–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)