Araneus detrimentosus

(O.Pickard-Cambridge, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records385

Data sources8

Biological traits0

DNA specimens3

eDNA detections18

Sources8 archives

Databases and archives Araneus detrimentosus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility385 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF385 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD3 specimens

01Narrative

Araneus detrimentosus is a species of orb weaver in the spider family Araneidae. It is found in a range from the United States to Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus detrimentosus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes1

BIN1

Where individuals differ — all 13 variable positions, in barcode order

85Tvariable

109Gvariable

343Cvariable

349Avariable

355Gvariable

411Cvariable

478Avariable

487Gvariable

500Tvariable

532Tvariable

544Cvariable

595Cvariable

653Cvariable

TACTATATATTTGATTTTTGGAGCTTGATCAGCTATAGTAGGAACGGCTATAAGAGTATTAATTCGAATTGAATTAGGTCAACCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona tianmenensissame family11.2%Larinioides patagiatussame family11.9%Neoscona subfuscasame family12.1%Neoscona arabescasame family12.3%Araneus groenlandicolasame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type385 records

Wild obs. + sensor373

Museum / vouchered12

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 196≤1 km 52≤10 km 14>10 km 53

315 georeferenced · 58 without coordinates

Open the mapobservation + sensor373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	9
San Diego, US	1
Buenos Aires, AR	1
Cambridge, US	1

4 institutions · 12 of 12 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Araneus detrimentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 18.7–24.6

Seasonal swing summer↔winter6.60 °C

Max temp (day)22.9 °C 22.3–29.7

Min temp (night)17.0 °C 16.1–20.9

Precipitation8.40 mm/mo 0.7–137

Air humidity67.0 % 57.8–67.8

Moisture balance-162 mm/mo -165–49.9

Vapour deficit741 Pa 737–1,219

Wind speed4.00 m/s 3.70–6.70

Cloud cover13.3 % 10.8–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)