Aralia excelsa

(Griseb.) J.Wen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Araliaceae/Aralia

At a glance

Occurrence records2 262

Data sources7

Biological traits19

DNA specimens13

eDNA detections7

Sources7 archives

Databases and archives Aralia excelsa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF2 262 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

Aralia excelsa é uma espécie vegetal do gênero Aralia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height max30 m

Seed volume4.2 mm³

Seed volume max4.2 mm³

Seed volume min4.2 mm³

Life cycle & reproduction4

Deciduousnessdrought deciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 400 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density436 mg/cm³

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aralia excelsa has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU054669.1 ↗606 bp

ACGT

TGCACAGCAGAACGACCCGCGAACATGTTACAACACCGGGTAAGGGACGAAGGGTGTGCAAGCTCCCCAAGTCGCGAACCCATGGTCGGG …

Sciadodendron excelsum voucher Nee & Wen 53845 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 262 records

Wild obs. + sensor2 113

Museum / vouchered148

Cultivated / captive1

Origin

Native11

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 8≤1 km 2≤10 km 2>10 km 4

16 georeferenced · 2 097 without coordinates

Open the mapobservation + sensor2 113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence148

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	70
León, NI	14
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	8
Antiguo Cuscatlán, SV	8
Kew, GB	6
Area de Conservacion Guanacastelocation not on record	4
San José, CR	4
MEXUlocation not on record	3
Berlin, DE	3
UNESP-IBILCElocation not on record	2
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	2
Universidad del Tolima (UT)location not on record	2
USP-IBlocation not on record	2
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	2
University of Stellenboschlocation not on record	2
IAvHlocation not on record	1
Aarhus, DK	1
Chicago, US	1
Universidad de San Carlos de Guatemalalocation not on record	1
Bronx, US	1
BMlocation not on record	1
Universidad de El Salvadorlocation not on record	1
Santa Cruz de la Sierra, BO	1
EL PASO, US	1
San Isidro, AR	1
SCZlocation not on record	1
Universidade Paulistalocation not on record	1

27 institutions · 144 of 148 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Aralia excelsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.9–25.8

Seasonal swing summer↔winter2.00 °C

Max temp (day)26.6 °C 26.6–28.0

Min temp (night)23.4 °C 23.4–24.0

Precipitation114 mm/mo 114–193

Air humidity68.0 % 66.2–68.0

Moisture balance-20.2 mm/mo -20.2–26.5

Vapour deficit1,003 Pa 1,003–1,125

Wind speed4.00 m/s 3.50–4.00

Cloud cover30.9 % 30.7–30.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aralia excelsa

At a glance

Sources7 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

At a glance

Record type2 262 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 262 records