Araeoncus humilis

(Blackwall, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Araeoncus

At a glance

Occurrence records5 492

Data sources8

Biological traits13

DNA specimens18

eDNA detections141

Sources8 archives

Databases and archives Araeoncus humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 492 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI141 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

World Spider Trait DBMasaryk University13 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources13 traits

Occurrence & distributionGBIF5 492 records

Environmental DNA5 datasets · 5 countries141 detections

DNA & barcodingBOLD18 specimens

01Narrative

Het bescheiden voorkopje is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Araeoncus. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1841 door John Blackwall.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Schirmel et al. 2012Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Bruun & Lissner 2019SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Kielhorn 2017Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Finch 2004Maelfait et al. 1998Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.6·♂1.5 mm

Predation4

Hunting guildsheet web weavers

Simple hunting guild IIwanderer

Simple hunting guild classificationweb-building

Web buildingno

Ecology8

Ballooningvery common

Light0.875 mm

Light 2open

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (*)

Stratumvegetation

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araeoncus humilis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections141

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

95Tmostly conserved

217Amostly conserved

271Amostly conserved

328Gmostly conserved

364Gmostly conserved

370Gmostly conserved

439Tmostly conserved

599Amostly conserved

600Amostly conserved

601Tmostly conserved

604Tmostly conserved

605Tmostly conserved

606Cmostly conserved

607Tmostly conserved

614Gmostly conserved

615Amostly conserved

617Cmostly conserved

619Amostly conserved

620Tmostly conserved

622Gmostly conserved

625Gmostly conserved

628Gmostly conserved

631Amostly conserved

634Cmostly conserved

637Tmostly conserved

638Gmostly conserved

640Tmostly conserved

641Tmostly conserved

643Amostly conserved

645Tmostly conserved

649Gmostly conserved

653Tmostly conserved

655Amostly conserved

GAGATTATATTTTATTTTTGGGGCATGGGCTGCTATAGTAGGGACAGCAATAAGAGTATTAATTCGAATTGAGTTAGGGCAAACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes3

BINs2

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dicymbium libidinosumsame family10.0%Praestigia sibiricasame family10.8%Praestigia groenlandicasame family10.9%Semljicola angulatussame family10.9%Ceratinella parvulasame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 492 records

Wild obs. + sensor3 000

Museum / vouchered2 377

Cultivated / captive26

Other89

Origin

Native1 725

Range

Area of Occupancy AOO3 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 337≤1 km 88≤10 km 2 296>10 km 5

2 726 georeferenced · 274 without coordinates

Open the mapobservation + sensor3 000

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 160≤1 km 39≤10 km 1 693>10 km 4

1 896 georeferenced · 481 without coordinates

Open the institutions mapphysical evidence2 377

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the mapnot free-living26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	157
Tilburg, NL	75
Brussels, BE	61
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	59
Helsinki, FI	42
Adam Mickiewicz University in Poznańlocation not on record	40
SLU Artdatabankenlocation not on record	33
Zoologisches Museum Hamburglocation not on record	31
SNSDlocation not on record	31
Akademia Pomorska w Słupskulocation not on record	28
	28
Tartu, EE	18
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	13
Bonn, DE	11
Paro, BT	8
Copenhagen, DK	8
Ekaterinburg, RU	6
Geneva, CH	5
Uniwersytet w Białymstokulocation not on record	4
Provincia di Livornolocation not on record	4
SGAV-and-NHMDlocation not on record	4
Frankfurt am Main	3
Uniwersytet Łódzkilocation not on record	3
ARTlocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Bern, CH	2
Cambridge, US	2
ZSMlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	1
Ghent, BE	1
MZLUlocation not on record	1

35 institutions · 691 of 2 377 vouchered records shown · 1 686 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA141 detections

Where the DNA of Araeoncus humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found141

Studies independent surveys5

Countries5

Verifiable raw sequence linked121

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 141 detections have coordinates

Open the map5 countries0

Moor, lockerer BirkenwaldWallhecke auf LaubzweigensynanthropFlusstalmoor14. Artificial - Terrestrial | 14.5 Urban Ar…Sandheide, niedrige Vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 0.9–16.5

Seasonal swing summer↔winter17.8 °C

Max temp (day)14.8 °C 4.40–20.1

Min temp (night)8.60 °C -2.20–13.2

Precipitation66.7 mm/mo 39.6–84.5

Air humidity63.0 % 59.3–65.8

Moisture balance-6.20 mm/mo -54.8–34.7

Vapour deficit479 Pa 227–741

Wind speed4.00 m/s 2.70–5.20

Cloud cover51.6 % 41.3–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 139 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araeoncus humilis

At a glance

Sources8 archives

Morphometry1

Predation4

Ecology8

At a glance

Record type5 492 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 492 records